Saltar al contenido
Merck

EHU093481

MISSION® esiRNA

targeting human CFLAR

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATGCTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTTCTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTACAGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAGACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATTGGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATGGGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAACTAAATCTGGTTGCCCCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

H H Cheung et al.
Cell death & disease, 2, e146-e146 (2011-04-15)
Smac mimetic compounds (SMCs) are experimental small molecules that induce tumour necrosis factor alpha (TNFα)-dependent cancer cell death by targeting the inhibitor of apoptosis proteins. However, many cancer cell lines are resistant to SMC-mediated apoptosis despite the presence of TNFα.
Reyaz ur Rasool et al.
Scientific reports, 6, 18800-18800 (2016-01-06)
The eukaryotic translation initiation factor 4E (eIF4E) is considered as a key survival protein involved in cell cycle progression, transformation and apoptosis resistance. Herein, we demonstrate that medicinal plant derivative 3-AWA (from Withaferin A) suppressed the proliferation and metastasis of
Therese Bredholt et al.
Molecular cancer, 8, 101-101 (2009-11-17)
An organic extract of the recreational herb khat (Catha edulis Forsk.) triggers cell death in various leukemia cell lines in vitro. The chemotherapeutics camptothecin, a plant alkaloid topoisomerase I inhibitor, was tested side-by-side with khat in a panel of acute
Andre van Krüchten et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(5), 2779-2793 (2018-02-07)
Superinfections with Staphylococcus aureus are a major complication of influenza disease, causing excessive inflammation and tissue damage. This enhanced cell-damaging effect is also observed in superinfected tissue cultures, leading to a strong decrease in overall cell viability. In our analysis
X Song et al.
Cell death & disease, 4, e577-e577 (2013-04-06)
Colorectal cancer is the third leading cause of cancer-related mortality in the world; the main cause of death of colorectal cancer is hepatic metastases, which can be treated with hyperthermia using isolated hepatic perfusion (IHP). In this study, we report

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico