EHU105821
MISSION® esiRNA
targeting human MST1
Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCAGTAGCCAAGATGGTGTGTGGGCCCTCAGGCTCCCAGCTTGTCCTGCTCAAGCTGGAGAGATCTGTGACCCTGAACCAGCGTGTGGCCCTGATCTGCCTGCCCCCTGAATGGTATGTGGTGCCTCCAGGGACCAAGTGTGAGATTGCAGGCTGGGGTGAGACCAAAGGTACGGGTAATGACACAGTCCTAAATGTGGCCTTGCTGAATGTCATCTCCAACCAGGAGTGTAACATCAAGCACCGAGGACGTGTGCGGGAGAGTGAGATGTGCACTGAGGGACTGTTGGCCCCTGTGGGGGCCTGTGAGGGTGACTACGGGGGCCCACTTGCCTGCTTTACCCACAACTGCTGGGTCCTGGAAGGAATTATAATCCCCAACCGAGTATGCGCAAGGTCCCGCTGGCCAGCTGTCTTCACGCGTGTCTCTGTGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MST1(4485)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Liver × receptor ligands disrupt breast cancer cell proliferation through an E2F-mediated mechanism.
Trang Nguyen-Vu et al.
Breast cancer research : BCR, 15(3), R51-R51 (2013-07-03)
Liver × receptors (LXRs) are members of the nuclear receptor family of ligand-dependent transcription factors and have established functions as regulators of cholesterol, glucose, and fatty acid metabolism and inflammatory responses. Published reports of anti-proliferative effects of synthetic LXR ligands
E2F2 induction in related to cell proliferation and poor prognosis in non-small cell lung carcinoma.
Li Chen et al.
International journal of clinical and experimental pathology, 8(9), 10545-10554 (2015-12-01)
E2F transcription factors regulate a wide range of biological processes, including cell cycle, apoptosis and DNA damage response. In the present study, we examined whether E2F2 is related to the poor prognosis of NSCLC and its role in progress of
Shiguan Wang et al.
Arthritis research & therapy, 20(1), 225-225 (2018-10-06)
Expression of E2F transcription factor 2 (E2F2), a transcription factor related to the cell cycle, is abnormally high in rheumatoid arthritis synovial fibroblasts (RASFs). Deregulated expression of E2F2 leads to abnormal production of proinflammatory cytokines, such as interleukin (IL)-1α, IL-1β