Saltar al contenido
Merck

EHU113211

MISSION® esiRNA

targeting human MFN1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGCTAAGAAGGCGATTACTGCAATCTTTGACCAGTTACTGGAGTTTGTTACTGAAGGATCACATTTTGTTGAAGCAACATATAAGAATCCGGAACTTGATCGAATAGCCACTGAAGATGATCTGGTAGAAATGCAAGGATATAAAGACAAGCTTTCCATCATTGGTGAGGTGCTATCTCGGAGACACATGAAGGTGGCATTTTTTGGCAGGACAAGCAGTGGGAAGAGCTCTGTTATCAATGCAATGTTGTGGGATAAAGTTCTCCCTAGTGGGATTGGCCATATAACCAATTGCTTCCTAAGTGTTGAAGGAACTGATGGAGATAAAGCCTATCTTATGACAGAAGGATCAGATGAAAAAAAGAGTGTGAAGACAGTTAATCAACTGGCCCATGCCCTTCACATGGACAAAGATTTGAAAGCTGGCTGTCTTGTACGTGTGTTTTGGCCAAAAGCAAAATGTGCCCTCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MFN1(55669)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Qian Zhou et al.
Vascular pharmacology, 72, 163-171 (2015-05-28)
Angiogenesis is defined as the sprouting of capillaries from pre-existing vasculature. It is a complex process that includes endothelial proliferation, migration, and tube formation. Previous data have demonstrated a high expression level of manganese-superoxide dismutase (MnSOD) in endothelial cells and
Sarah L Sawyer et al.
Human molecular genetics, 24(18), 5109-5114 (2015-06-19)
Multiple symmetric lipomatosis (MSL) is a mitochondrial disorder with impaired brown fat metabolism that has been associated with MERRF mutations in some, but not all, patients. We studied a sibling pair and an unrelated indiviadual who presented with MSL and
Chih-Wei Chen et al.
International journal of molecular sciences, 21(14) (2020-07-28)
NME3 is a member of the nucleoside diphosphate kinase (NDPK) family that binds to the mitochondrial outer membrane to stimulate mitochondrial fusion. In this study, we showed that NME3 knockdown delayed DNA repair without reducing the cellular levels of nucleotide