Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HNRNPC(3183)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
N Balaguer et al.
Molecular human reproduction, 24(8), 411-425 (2018-05-31)
Is there a specific mechanism to load the microRNA (miRNA), hsa-miR-30d, into exosomes to facilitate maternal communication with preimplantation embryos? The heterogeneous nuclear ribonucleoprotein C1 (hnRNPC1) is involved in the internalization of endometrial miR-30d into exosomes to prepare for its
Qi Chen et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 28(11), 2503-2518 (2020-07-19)
Dendritic cells (DCs) can orchestrate either immunogenic or tolerogenic responses to relay information on the functional state. Emerging studies indicate that circular RNAs (circRNAs) are involved in immunity; however, it remains unclear whether they govern DC development and function at
Zuzana Cieniková et al.
RNA (New York, N.Y.), 21(11), 1931-1942 (2015-09-16)
The human hnRNP C is a ubiquitous cellular protein involved in mRNA maturation. Recently, we have shown that this protein specifically recognizes uridine (U) pentamers through its single RNA recognition motif (RRM). However, a large fraction of natural RNA targets