Saltar al contenido
Merck

EHU141461

MISSION® esiRNA

targeting human RELA

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human RELA

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTCACCAAGGACCCTCCTCACCGGCCTCACCCCCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTCTATGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGTTTCCAGAACCTGGGAATCCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTCAGCGCATCCAGACCAACAACAACCCCTTCCAAGTTCCTATAGAAGAGCAGCGTGGGGACTACGACCTGAATGCTGTGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCCTCCGCCTGCCGCCTGTCCTTTCTCATCCCATCTTTGACAATCGTGCCCCCAACACTGCCGAGCTCAAGAT

Ensembl | human accession no.

ENSG00000173039

NCBI accession no.

NM_001145138

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... RELA(5970), RELA(5970)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
CVU
HRU
DPU
MCU
IYT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xu Wang et al.
Journal of cellular and molecular medicine, 21(12), 3420-3434 (2017-06-24)
Catalase is an antioxidative enzyme that converts hydrogen peroxide (H
Ichiro Yajima et al.
Archives of toxicology, 91(11), 3507-3516 (2017-05-05)
Chronic exposure to arsenic is associated with various diseases in humans. Skin hyperpigmentation is the most sensitive objective symptom for patients with arsenicosis. However, there is very limited information about the mechanism of arsenic-mediated skin hyperpigmentation in vivo. In this
Andrea Floris et al.
Journal of experimental & clinical cancer research : CR, 38(1), 4-4 (2019-01-07)
Ethanol abuse promotes breast cancer development, metastasis and recurrence stimulating mammary tumorigenesis by mechanisms that remain unclear. Normally, 35% of breast cancer is Erb-B2 Receptor Tyrosine Kinase 2 (ERBB2)-positive that predisposes to poor prognosis and relapse, while ethanol drinking leads
Francis Migneault et al.
Scientific reports, 10(1), 12562-12562 (2020-07-30)
Persistent endothelial injury promotes maladaptive responses by favoring the release of factors leading to perturbation in vascular homeostasis and tissue architecture. Caspase-3 dependent death of microvascular endothelial cells leads to the release of unique apoptotic exosome-like vesicles (ApoExo). Here, we
Xiu-Lei Zhang et al.
Biochimica et biophysica acta. General subjects, 1863(10), 1443-1457 (2019-05-20)
Lung cancer is the leading cause of global cancer deaths. Current chemotherapeutic agents for lung cancer treatment are generally accompanied with severe side effects. Here, we report that marchantin C (Mar-C), a potential natural compound with little chemotherapeutic toxicity, exerts
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico