Saltar al contenido
Merck

EMU006511

MISSION® esiRNA

targeting mouse Dync2li1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACTACGGAGCCTCGCTGATGTTTACCAGCAAGTCAGAAGCTCTGTTACTGAAGATACGCGGTGTTATCAACCAGTTGGCATTCGGTATTGATAAAAGCAAATCAATATGTGTGGATCAAAATAAGCCACTGTTTATCACAGCAGGACTGGATTCTTTATGTCAGATAGGGTCTCCTCCTGTTCCTGACAGTGACATTGGAAAACTTCAGGCCCACTCACCTATGGAGCTGTGGAAAAAGGTGTATGACAAGCTCTTCCCACCAAAGAGTACCGGCACCCTGAAGGCGGTCCAGGACCCAGCCCGAGACCCGCAGTATGCAGAAAGCGAAGTCGATGAGATGAGGGTTCAGAAGGACCAGGAACTAGAACACTACAAGAGAAGCTCCTCTAAGACCTGGAAGCAAATCGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kristin Kessler et al.
Scientific reports, 5, 11649-11649 (2015-07-02)
Skeletal ciliopathies are a heterogeneous group of autosomal recessive osteochondrodysplasias caused by defects in formation, maintenance and function of the primary cilium. Mutations in the underlying genes affect the molecular motors, intraflagellar transport complexes (IFT), or the basal body. The
S Paige Taylor et al.
Nature communications, 6, 7092-7092 (2015-06-17)
The short rib polydactyly syndromes (SRPSs) are a heterogeneous group of autosomal recessive, perinatal lethal skeletal disorders characterized primarily by short, horizontal ribs, short limbs and polydactyly. Mutations in several genes affecting intraflagellar transport (IFT) cause SRPS but they do

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico