Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGAGCGGACCTTCAGGAATTGGATGAACTCCCTGGGCGTTAACCCGCGCGTCAATCACTTGTACAGTGACTTATCGGATGCCTTAGTCATCTTCCAGCTCTATGAGAAGATCAAAGTCCCTGTTGATTGGAACAGAGTAAACAAGCCTCCATACCCCAAGCTGGGGGGCAATATGAAAAAGCTGGAGAACTGTAATTATGCAGTGGACCTGGGGAAGAATCAAGCTAAATTCTCCCTGGTTGGCATCGCAGGACAAGACCTCAATGAAGGAAACCGAACTCTCACGCTGGCATTGGTTTGGCAGCTCATGAGAAGGTACACACTGAATATCCTGGAAGATATCGGAGGTGGACAGAAGGTCAATGATGACATTATTGTCAACTGGGTGAATACGACCTTGAAGGAGGCACAGAAAAGCTCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... LCP1(18826), Lcp1(18826)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Ping-Ping He et al.
Biochimie, 106, 81-90 (2014-08-26)
Accumulating evidence suggests that microRNA-590 (miR-590) has protective effects on cardiovascular diseases, but the mechanism is unknown. Interestingly, previous studies from our laboratory and others have shown that macrophage-derived lipoprotein lipase (LPL) might accelerate atherosclerosis by promoting lipid accumulation and
Majib Jan et al.
Biochemical and biophysical research communications, 462(1), 33-37 (2015-05-02)
In previous studies, we demonstrated that down-regulation of lipoprotein lipase in L6 muscle cells increased insulin-stimulated glucose uptake. In the current study, we used RNA interference technology to silence the LPL gene in L6 cells and generate a LPL-knock-down (LPL-KD)
Uri Rozovski et al.
Molecular cancer research : MCR, 13(5), 944-953 (2015-03-04)
While reviewing chronic lymphocytic leukemia (CLL) bone marrow slides, we identified cytoplasmic lipid vacuoles in CLL cells but not in normal B cells. Because lipoprotein lipase (LPL), which catalyzes hydrolysis of triglycerides into free fatty acids (FFA), is aberrantly expressed