Saltar al contenido
Merck

EMU078861

MISSION® esiRNA

targeting mouse Ep300

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTGTCCTTCACCACGAGATCATCTGGCCATCTGGGTTTGTCTGTGATGGCTGTTTAAAGAAAACTGCACGAACTAGGAAAGAAAATAAGCTTTCTGCTAAAAGATTGCCATCTACCAGACTTGGGACCTTTCTGGAGAATCGAGTGAATGACTTTCTGAGGCGACAAAATCACCCTGAATCAGGAGAGGTCACTGTTCGGGTTGTTCATGCTTCTGACAAAACTGTGGAAGTGAAACCAGGCATGAAAGCAAGGTTTGTAGATAGTGGAGAGATGGCAGAATCTTTTCCATACCGAACAAAGGCCCTGTTTGCCTTTGAAGAAATTGATGGTGTTGACTTGTGTTTCTTCGGCATGCATGTTCAAGAATATGGCTCTGACTGCCCCCCTCCCAACCAGAGGAGGGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Guanqiao Wang et al.
Cellular signalling, 27(7), 1369-1379 (2015-04-07)
Carbonic anhydrase IX(CA9)is a member of the carbonic anhydrase family that catalyzes the reversible hydration of carbon dioxide, and plays a key role in the regulation of pH. Although a large number of studies have shown that CA9 is strongly
Erli Zhang et al.
PloS one, 10(12), e0143814-e0143814 (2015-12-03)
Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and
Jihong Chen et al.
Scientific reports, 5, 13727-13727 (2015-09-12)
Skeletal myogenesis is a highly ordered process which specifically depends on the function of transcriptional coactivator p300. Previous studies have established that Akt/protein kinase B (PKB), a positive regulator of p300 in proliferating cells, is also important for proper skeletal