Accéder au contenu
Merck

EHU000311

MISSION® esiRNA

targeting human IRF1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGAAAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGTGGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACTCCAGCACTGTCGCCATGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAAGTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACCTCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTCTTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAACCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATTGACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATGGATGCCACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRF1(3659)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents


Contenu apparenté

Instructions


Z-D Liu et al.
European review for medical and pharmacological sciences, 24(23), 12334-12341 (2020-12-19)
Cerebral ischemia/reperfusion (CIR) frequently causes serious disabilities and correlates with certain neurological processes. Some studies have shown that microRNAs (miRNAs) exert a neuroprotective effect by modulating the inflammatory process in CIR. However, the biofunction and the mechanism of miR-130b in
Jianhua Liu et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(9), 1840-1849 (2017-06-01)
The inflammasome complex is a driver of organ damage in patients with systemic lupus erythematosus (SLE). Although type I interferons (IFNs) are well established as mediators of SLE pathogenesis, their role in inflammasome activation in SLE has not been assessed.
Yihe Yan et al.
Cancer immunology, immunotherapy : CII, 69(9), 1891-1903 (2020-05-08)
The objective response rate of immune checkpoint blockade (ICB) in hepatocellular carcinoma (HCC) with anti PD-L1/PD-1 therapy is low. Discovering the signaling pathways regulating PD-L1 might help to improve ICB response rates. Here, we investigate transcription factors IRF-1 and IRF-2