Accéder au contenu
Merck

EHU002001

MISSION® esiRNA

targeting human HDAC2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTACATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTACAGTGTGGTGCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HDAC2(3066)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wen-Feng Fang et al.
Journal of inflammation (London, England), 15, 3-3 (2018-01-19)
Sepsis is a life-threatening organ dysfunction caused by dysregulated host response to infection, and is primarily characterized by an uncontrolled systemic inflammatory response. In the present study, we developed an effective adjunct therapy mediated by a novel mechanism, to attenuate
Jie Gao et al.
Gene, 678, 1-7 (2018-08-01)
Chronic diabetic foot ulcer (DFU) is a major cause of disability and mortality in patients with diabetes. Dysfunctional endothelial progenitor cells (EPCs) play important roles in preventing vascular complications in these patients. Our results determined the elevated expression of histone
David B Wang et al.
Brain pathology (Zurich, Switzerland), 29(2), 164-175 (2018-07-22)
Histone deacetylases (HDACs) catalyze acetyl group removal from histone proteins, leading to altered chromatin structure and gene expression. HDAC2 is highly expressed in adult brain, and HDAC2 levels are elevated in Alzheimer's disease (AD) brain. We previously reported that neuron-specific
Baojie Zhang et al.
Cancers, 11(5) (2019-05-15)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is considered as a promising anti-cancer therapeutic. However, many cancers have been found to be or to become inherently resistant to TRAIL. A combination of epigenetic modifiers, such as histone deacetylase inhibitors (HDACi's), with
Ziran Wang et al.
Molecular therapy oncolytics, 17, 547-561 (2020-07-09)
Hepatocellular carcinoma (HCC) is a common malignant tumor. LukS-PV is the S component of Panton-Valetine leukocidin (PVL), which is secreted by Staphylococcus aureus. This study investigated the effects of LukS-PV on the proliferation, apoptosis, and cell-cycle progression of HCC cells

Contenu apparenté

Instructions

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique