Accéder au contenu
Merck

EHU012751

MISSION® esiRNA

targeting human LEP

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGAAAGTCACCGGTTTGGACTTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCTACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTGGAGAACCTCCGGGATCTTCTTCACGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGGGGTGTCCTGGAAGCTTCAGGCTACTCCACAGAGGTGGTGGCCCTGAGCAGGCTGCAGGGGTCTCTGCAGGACATGCTGTGGCAGCTGGACCTCAGCCCTGGGTGCTGAGGCCTTGAAGGTCACTCTTCCTGCAAGGACTACGTTAAGGGAAGGAACTCTGGCTTCCAGGTATCTCCAGGATTGAAGAGCATTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... LEP(3952), LEP(3952)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Beniamin Oskar Grabarek et al.
International journal of molecular sciences, 22(4) (2021-02-11)
Psoriasis is a disease with a proinflammatory base, in which an increased expression of leptin, tumor necrosis factor alpha (TNF-α), interleukin (IL) IL-12/23, IL-6, is observed. A drug used in the treatment of psoriasis of moderate and acute strength is
Dariusz Dąbruś et al.
International journal of molecular sciences, 21(11) (2020-06-14)
This research aimed to assess the impact of cisplatin, depending on the concentration and exposure time, on the expression pattern of leptin in an endometrial cancer cell line. Ishikawa endometrial cancer cell cultures were incubated with cisplatin, at concentrations of
Amy L Strong et al.
Breast cancer research : BCR, 17, 112-112 (2015-08-20)
The steady increase in the incidence of obesity among adults has been paralleled with higher levels of obesity-associated breast cancer. While recent studies have suggested that adipose stromal/stem cells (ASCs) isolated from obese women enhance tumorigenicity, the mechanism(s) by which

Contenu apparenté

Instructions

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique