Accéder au contenu
Merck

EHU022531

MISSION® esiRNA

targeting human ULK1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGAACCTCGCCAAGTCTCAGACGCTGCTGGGGAAGGAAATCAAAATCCTGAAGGAACTGAAACATGAAAACATCGTGGCCCTGTACGACTTCCAGGAAATGGCTAATTCTGTCTACCTGGTTATGGAGTACTGCAACGGTGGGGACCTGGCCGACTACCTGCACGCCATGCGCACGCTGAGCGAGGACACCATCAGGCTCTTCCTGCAGCAGATCGCGGGCGCCATGCGGCTTCTGCACAGCAAAGGCATCATCCACCGCGACCTGAAACCGCAGAACATCCTGCTGTCCAACCCCGCCGGCCGCCGCGCCAACCCCAACAGCATCCGCGTCAAGATCGCTGACTTCGGCTTCGCGCGGTACCTCCAGAGCAACATGATGGCGGCCACACTCTGCGGCTCCCCCATGTACATGGCCCCCGAGGTCATCATGTCCCAGCACTACGACGGGAAGGCGGACCTGTGGAGCATCGGCACCATCGTCTACCAGTGCCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Katrin Spengler et al.
Cells, 9(3) (2020-03-15)
AMP-activated protein kinase (AMPK) is activated by vascular endothelial growth factor (VEGF) in endothelial cells and it is significantly involved in VEGF-induced angiogenesis. This study investigates whether the VEGF/AMPK pathway regulates autophagy in endothelial cells and whether this is linked
Min Liu et al.
Toxicology letters, 283, 106-115 (2017-11-13)
Mitochondrial aldehyde dehydrogenase 2 (ALDH2), an important enzyme in the elimination of toxic aldehydes, is involved in cardioprotection against diabetes mellitus. This study was designed to examine the mechanism behind ALDH2-offered protection against high glucose exposure with a focus on
Arup Sarkar et al.
The Journal of infectious diseases, 216(12), 1655-1666 (2017-10-14)
Macrophages are specialized phagocytic cells involved in clearing invading pathogens. Previously we reported that engulfment and cell motility protein 1 (ELMO1) in macrophages mediates bacterial internalization and intestinal inflammation. Here we studied the role of ELMO1 in the fate of
Yalitza Lopez Corcino et al.
Scientific reports, 9(1), 669-669 (2019-01-27)
Little is known about strategies used by pathogens to facilitate CNS invasion. Toxoplasma gondii reaches the CNS by circulating in blood within leukocytes or as extracellular tachyzoites. T. gondii induces EGFR signaling in vitro during invasion of mammalian cells. We
Qiang Xiao et al.
Theranostics, 10(22), 10245-10261 (2020-09-16)
Hepatocellular carcinoma (HCC) is the third most frequent cause of cancer-related deaths globally because of high metastasis and recurrence rates. Elucidating the molecular mechanisms of HCC recurrence and metastasis and developing effective targeted therapies are expected to improve patient survival.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique