Accéder au contenu
Merck

EHU027651

MISSION® esiRNA

targeting human SQSTM1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAACGTTGGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGGCGCCCTGAGGCAATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCACATCTCCCGCCAGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Catégories apparentées

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Akihito Arai et al.
American journal of cancer research, 7(4), 881-891 (2017-05-05)
Hypopharyngeal carcinoma is one of the worst prognostic malignancies among head and neck carcinomas. Therefore, a good biomarker should be identified to predict the best therapeutic option before starting the treatment. In cell models, p62/SQSTM1 levels affected the Nrf2-Keap1 pathway
Prasun Guha et al.
Oncotarget, 8(40), 68191-68207 (2017-10-06)
Studies suggest that tunicamycin may work as a therapeutic drug to cancer cells by inducing stress in the endoplasmic reticulum (ER) through unfolded protein response (UPR) and thereby promoting apoptosis. However, mechanisms of the prolonged activation of the UPR under
Alessia Garufi et al.
Biomolecules, 11(3) (2021-03-07)
The hyperactivation of nuclear factor erythroid 2 p45-related factor 2 (NRF2), frequently found in many tumor types, can be responsible for cancer resistance to therapies and poor patient prognosis. Curcumin has been shown to activate NRF2 that has cytotprotective or
Haofeng Ning et al.
Experimental and therapeutic medicine, 14(6), 5417-5423 (2017-12-30)
Macrophage autophagy has a protective role in the development of atherosclerosis; however, it turns dysfunctional in advanced lesions with an increase in p62/sequestosome-1 protein. Little is known about the role and significance of p62 accumulation in atherosclerosis. The present study

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique