Accéder au contenu
Merck

EHU032271

MISSION® esiRNA

targeting human IKBKG

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACTCCCTGTGAAGCTCTCCAGCATCATCGAGGTCCCATCAGGTGGGGAAAGATGCTGTTCCAGGCGCACACTAGTCTACAAGGCCAGAGCTTTCTGGAAGGGGGCACCCTTGCCCTGTTGGATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCAGAAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IKBKG(8517)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Sona Hubackova et al.
Aging, 4(12), 932-951 (2013-02-07)
Many cancers arise at sites of infection and inflammation. Cellular senescence, a permanent state of cell cycle arrest that provides a barrier against tumorigenesis, is accompanied by elevated proinflammatory cytokines such as IL1, IL6, IL8 and TNFα. Here we demonstrate
Jérôme Bouchet et al.
Journal of immunology (Baltimore, Md. : 1950), 198(7), 2967-2978 (2017-02-27)
The role of endosomes in receptor signal transduction is a long-standing question, which remains largely unanswered. The T cell Ag receptor and various components of its proximal signaling machinery are associated with distinct endosomal compartments, but how endosomal traffic affects
Verena Quennet et al.
Nucleic acids research, 39(6), 2144-2152 (2010-11-20)
Topoisomerases class II (topoII) cleave and re-ligate the DNA double helix to allow the passage of an intact DNA strand through it. Chemotherapeutic drugs such as etoposide target topoII, interfere with the normal enzymatic cleavage/re-ligation reaction and create a DNA