Accéder au contenu
Merck

EHU038621

MISSION® esiRNA

targeting human B2M

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATGTAAGCAGCATCATGGAGGTTTGAAGATGCCGCATTTGGATTGGATGAATTCCAAATTCTGCTTGCTTGCTTTTTAATATTGATATGCTTATACACTTACACTTTATGCACAAAATGTAGGGTTATAATAATGTTAACATGGACATGATCTTCTTTATAATTCTACTTTGAGTGCTGTCTCCATGTTTGATGTATCTGAGCAGGTTGCTCCACAGGTAGCTCTAGGAGGGCTGGCAACTTAGAGGTGGGGAGCAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... B2M(567)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Egle-Helene Ervin et al.
Stem cell research & therapy, 10(1), 43-43 (2019-01-27)
Human embryonic stem (hES) cells serve as an invaluable tool for research and future medicine, but their transfection often leads to unwanted side effects as the method itself may induce differentiation. On the other hand, RNA interference (RNAi)-based targeted gene
Zaruhi Karabekian et al.
Biomedical materials (Bristol, England), 10(3), 034101-034101 (2015-03-17)
The presence of non-autologous major histocompatibility complex class I (MHC-I) molecules on the surface of the grafted cells is one of the main reasons for their rejection in non-syngeneic hosts. We present a straightforward strategy to decrease the presence of
Matthew E Agwae et al.
Molecular biology reports, 47(5), 3987-3992 (2020-04-03)
iRhom2 is an inactive rhomboid protease involved in diverse signalling events. It has been implicated in the pathogenesis of a number of cancer types, including oesophageal and ovarian cancer, while its closely associated family member, iRhom1, is implicated in head
Marlieke L M Jongsma et al.
Immunity, 54(1), 132-150 (2020-12-04)
HLA class I (HLA-I) glycoproteins drive immune responses by presenting antigens to cognate CD8+ T cells. This process is often hijacked by tumors and pathogens for immune evasion. Because options for restoring HLA-I antigen presentation are limited, we aimed to identify

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique