Accéder au contenu
Merck

EHU038861

MISSION® esiRNA

targeting human GTF2H1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGTCCAACTCCAATCCAGTCACTACAGTATGCAACAAGTCAGGACATTATTAATTCTTTTCAAAGTATTAGACAAGAAATGGAAGCTTATACACCCAAGTTAACTCAGGTTCTCTCAAGTAGTGCTGCCAGTAGTACCATCACAGCACTGTCACCTGGAGGGGCACTTATGCAGGGAGGAACACAGCAAGCCATAAACCAGATGGTGCCAAATGATATTCAATCTGAATTGAAACACTTATATGTAGCTGTTGGAGAACTTCTACGACATTTCTGGTCCTGCTTTCCTGTTAATACGCCATTCCTAGAAGAAAAGGTAGTGAAAATGAAAAGTAATTTGGAACGATTCCAAGTTACGAAGCTCTGTCCATTCCAAGAAAAGATTCGGAGACAGTATTTAAGCACAAATTTGGTAAGTCACATAGAAGAGATGCTCCAGACAGCCTACAACAAGCTCCACACATGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GTF2H1(2965)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions