Accéder au contenu
Merck

EHU060601

MISSION® esiRNA

targeting human DNMT1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCACAGATGCTGACAAATGAGAAGCTGTCCATCTTTGATGCCAACGAGTCTGGCTTTGAGAGTTATGAGGCGCTTCCCCAGCACAAACTGACCTGCTTCAGTGTGTACTGTAAGCACGGTCACCTGTGTCCCATCGACACCGGCCTCATCGAGAAGAATATCGAACTCTTCTTTTCTGGTTCAGCAAAACCAATCTATGATGATGACCCATCTCTTGAAGGTGGTGTTAATGGCAAAAATCTTGGCCCCATAAATGAATGGTGGATCACTGGCTTTGATGGAGGTGAAAAGGCCCTCATCGGCTTCAGCACCTCATTTGCCGAATACATTCTGATGGATCCCAGTCCCGAGTATGCGCCCATATTTGGGCTGATGCAGGAGAAGATCTACATCAGCAAGATTGTGGTGGAGTTCCTGCAGAGCAATTCCGACTCGACCTATGAGGACCTGATCAACAAGATCGAGACCACGGTTCCTCCTTCT

Ensembl | human accession no.

ENSG00000130816

NCBI accession no.

NM_001379

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
OAV
NZU
CSU
CRU
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shuhao Fu et al.
Experimental eye research, 165, 47-58 (2017-09-13)
The principle reason of high failure rate of glaucoma filtration surgery is the loss of filtration function caused by postoperative scar formation. We investigated the effects of 5-aza-2'-deoxycytidine (5-Aza-dc), a DNA methyltransferases inhibitor, on human Tenon's capsule fibroblasts (HTFs) differentiation
Arunagiri Kuha Deva Magendhra Rao et al.
Molecular oncology, 13(6), 1342-1355 (2019-04-09)
Breast cancer is the most common malignancy among women, with the highest incidence rate worldwide. Dysregulation of long noncoding RNAs during the preliminary stages of breast carcinogenesis is poorly understood. In this study, we performed RNA sequencing to identify long
Fangcao Jin et al.
Stem cell research & therapy, 11(1), 444-444 (2020-10-21)
Dysfunction of the DNA methylation was associated with stem cell reprogramming. Moreover, DNA methyltransferase 1 (DNMT1) deficiency was involved in the differentiation of hair follicle stem cell (HFSc), but the molecular mechanisms remain unknown. HFSc from human scalp tissues were
Luisa Tomasello et al.
International journal of molecular sciences, 21(7) (2020-04-01)
Protein tyrosine phosphatase receptor type γ (PTPRG) is a tumor suppressor gene, down-regulated in Chronic Myeloid Leukemia (CML) cells by the hypermethylation of its promoter region. β-catenin (CTNNB1) is a critical regulator of Leukemic Stem Cells (LSC) maintenance and CML
Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique