Accéder au contenu
Merck

EHU061741

MISSION® esiRNA

targeting human BECN1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human BECN1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGAGAGACTGGATCAGGAGGAAGCTCAGTATCAGAGAGAATACAGTGAATTTAAACGACAGCAGCTGGAGCTGGATGATGAGCTGAAGAGTGTTGAAAACCAGATGCGTTATGCCCAGACGCAGCTGGATAAGCTGAAGAAAACCAACGTCTTTAATGCAACCTTCCACATCTGGCACAGTGGACAGTTTGGCACAATCAATAACTTCAGGCTGGGTCGCCTGCCCAGTGTTCCCGTGGAATGGAATGAGATTAATGCTGCTTGGGGCCAGACTGTGTTGCTGCTCCATGCTCTGGCCAATAAGATGGGTCTGAAATTTCAGAGATACCGACTTGTTCCTTACGGAAACCATTCATATCTGGAGTCTCTGACAGACAAATCTAAGGAGCTGCCGTTATACTGTTCTGGGGGGTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTGGCTTTCCTGGACTGTGTGCAG

Ensembl | human accession no.

ENSG00000126581

NCBI accession no.

NM_003766

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... BECN1(8678), BECN1(8678)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
UBV
TTU
TOU
BOU
IYT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jingjing Wu et al.
Journal of cellular and molecular medicine, 22(2), 1190-1201 (2017-10-28)
Long-term peritoneal dialysis is accompanied by functional and histopathological alterations in the peritoneal membrane. In the long process of peritoneal dialysis, high-glucose peritoneal dialysis solution (HGPDS) will aggravate the peritoneal fibrosis, leading to decreased effectiveness of peritoneal dialysis and ultrafiltration
Haoran Peng et al.
Viruses, 10(5) (2018-05-16)
Autophagy is a common strategy for cell protection; however, some viruses can in turn adopt cellular autophagy to promote viral replication. Zika virus (ZIKV) is the pathogen that causes Zika viral disease, and it is a mosquito-borne virus. However, its
Guangmin Xi et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1610-1616 (2016-11-09)
Multidrug resistance (MDR) is a major obstacle for successful chemotherapy treatment. Searching for effective MDR modulators and combining them with anticancer drug therapies has been a promising strategy against clinical MDR. In our previous study, we have found that DHA-E3
Michelle M Coleman et al.
American journal of respiratory cell and molecular biology, 59(5), 548-556 (2018-06-01)
Vitamin A deficiency strongly predicts the risk of developing tuberculosis (TB) in individuals exposed to Mycobacterium tuberculosis (Mtb). The burden of antibiotic-resistant TB is increasing globally; therefore, there is an urgent need to develop host-directed adjunctive therapies to treat TB.
Wenkang Luan et al.
OncoTargets and therapy, 10, 4569-4577 (2017-10-27)
Autophagy is not only a survival response to growth-factor or nutrient deprivation but also an important mechanism for tumor-cell suicide, including melanoma.
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique