Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGGCAAGTATGTAGGCCTTGTAAGAGTATTGGCAAAGCATGGCAAGCTCCAAGATGCTATTAACATTCTGAAGGAGATGAAAGAGAAGGATGTTCTTATCAAAGATACAACAGCCTTGTCCTTTTTCCACATGCTAAATGGCGCAGCTTTAAGAGGTGAAATTGAAACAGTAAAACAGTTGCATGAAGCCATCGTGACTCTAGGGTTAGCAGAACCATCCACCAACATAAGTTTCCCATTGGTCACTGTACACTTGGAAAAGGGCGACCTATCTACTGCTCTTGAGGTCGCCATTGACTGCTATGAAAAGTATAAAGTATTACCAAGGATTCATGATGTCTTGTGTAAACTGGTAGAGAAAGGCGAGACTGATCTAATTCAGAAAGCAATGGACTTTGTGAGCCAAGAACAAGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LRPPRC(10128)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Stephany Corrêa et al.
Epigenetics, 9(8), 1172-1183 (2014-08-05)
One of the potential mechanisms of imatinib mesylate (IM) resistance in chronic myeloid leukemia (CML) is increased level of P-glycoprotein (Pgp). Pgp is an efflux pump capable of activating the multidrug resistance (MDR) phenotype. The gene encoding Pgp (ABCB1) has
Keiko Fujimoto et al.
Molecular pharmacology, 88(4), 660-675 (2015-07-17)
Tocilizumab (TCZ), a humanized anti-interleukin-6 (IL-6) receptor (IL-6R) monoclonal antibody, abrogates signal transducer protein gp130-mediated IL-6 signaling by competitively inhibiting the binding of IL-6 to the receptor, and shows clinical efficacy in autoimmune and inflammatory diseases. Despite accumulating evidence for