Accéder au contenu
Merck

EHU065071

MISSION® esiRNA

targeting human ITGB1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kathleen Wantoch von Rekowski et al.
Biomolecules, 9(12) (2019-11-30)
Tumor cell binding to the microenvironment is regarded as the onset of therapeutic resistance, referred to as cell adhesion mediated drug resistance (CAM-DR). Here we elucidate whether CAM-DR occurs in ovarian cancer cells and contributes to still-existing cisplatin resistance. Cultivation
Wenjie Yang et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 132-144 (2020-02-13)
This study aimed to investigate the regulatory mechanism of circular RNA CSPP1 (hsa_circ_CSPP1) in cervical cancer. Based on GEO database, differentially expressed circRNAs and mRNAs related to cervical cancer were screened out by R software. Kyoto Encyclopedia of Genes and
Cherine Abou Faycal et al.
British journal of cancer, 118(12), 1596-1608 (2018-05-26)
While lung adenocarcinoma patients can somewhat benefit from anti-angiogenic therapies, patients with squamous cell lung carcinoma (SQLC) cannot. The reasons for this discrepancy remain largely unknown. Soluble VEGF receptor-1, namely sVEGFR1-i13, is a truncated splice variant of the cell membrane-spanning
Tao Yin et al.
Molecular medicine reports, 12(4), 5093-5099 (2015-08-05)
Ischemic diseases represent a challenging worldwide health burden. The current study investigated the therapeutic potential of genetically modified human placenta‑derived mesenchymal stem cells (hPDMSCs) with basic fibroblast growth factor (FGF2) and platelet‑derived growth factor‑BB (PDGF‑BB) genes in hindlimb ischemia. Mesenchymal
Asma Boudria et al.
Oncogene, 38(7), 1050-1066 (2018-09-09)
Vascular endothelial growth factor-A (VEGF-A) is highly subjected to alternative pre-mRNA splicing that generates several splice variants. The VEGFxxx and VEGFxxxb families encode splice variants of VEGF-A that differ only at the level of six amino acids in their C-terminal

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique