Accéder au contenu
Merck

EHU069871

MISSION® esiRNA

targeting human NRF1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGTGACCCAAACCGAACATATGGCTACCATAGAAGCACATGCAGTGGCCCAGCAAGTGCAGCAGGTCCATGTGGCTACTTACACCGAGCATAGTATGCTGAGTGCTGATGAAGACTCGCCTTCTTCTCCCGAGGACACCTCTTACGATGACTCAGATATACTCAACTCCACAGCAGCTGATGAGGTGACAGCTCATCTGGCAGCTGCAGGTCCTGTGGGAATGGCCGCTGCTGCTGCTGTGGCAACAGGAAAGAAACGGAAACGGCCTCATGTATTTGAGTCTAATCCATCTATCCGGAAGAGGCAACAAACACGTTTGCTTCGGAAACTTCGAGCCACGTTAGATGAATATACTACTCGTGTGGGACAGCAAGCTATTGTCCTCTGTATCTCACCCTCCAAACCTAACCCTGTCTTTAAAGTGTTTGGTGCAGCACCTTTGGAGAATGTGGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... NRF1(4899)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Victoria Sid et al.
Journal of molecular medicine (Berlin, Germany), 96(11), 1203-1213 (2018-09-05)
Folate is an essential micronutrient for biological function. The liver, a primary organ for folate metabolism and storage, plays an important role in folate homeostasis. Proton-coupled folate transporter (PCFT) and reduced folate carrier (RFC) are the major folate transporters responsible
Luqing Zhao et al.
Oncotarget, 6(18), 15995-16018 (2015-07-24)
microRNAs (miRNAs) are involved in the various processes of DNA damage repair and play crucial roles in regulating response of tumors to radiation therapy. Here, we used nasopharyngeal carcinoma (NPC) radio-resistant cell lines as models and found that the expression
V O Okoh et al.
British journal of cancer, 112(10), 1687-1702 (2015-05-13)
17β-Oestradiol (E2)-induced reactive oxygen species (ROS) have been implicated in regulating the growth of breast cancer cells. However, the underlying mechanism of this is not clear. Here we show how ROS through a novel redox signalling pathway involving nuclear respiratory

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique