Accéder au contenu
Merck

EHU077321

MISSION® esiRNA

targeting human PTK2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATCCCACACATCTTGCTGACTTCACTCAAGTGCAAACCATTCAGTATTCAAACAGTGAAGACAAGGACAGAAAAGGAATGCTACAACTAAAAATAGCAGGTGCACCCGAGCCTCTGACAGTGACGGCACCATCCCTAACCATTGCGGAGAATATGGCTGACCTAATAGATGGGTACTGCCGGCTGGTGAATGGAACCTCGCAGTCATTTATCATCAGACCTCAGAAAGAAGGTGAACGGGCTTTGCCATCAATACCAAAGTTGGCCAACAGCGAAAAGCAAGGCATGCGGACACACGCCGTCTCTGTGTCAGAAACAGATGATTATGCTGAGATTATAGATGAAGAAGATACTTACACCATGCCCTCAACCAGGGATTATGAGATTCAAAGAGAAAGAATAGAACTTGGACGATGTATTGGAGAAGGCCAATTTGGAGATG

Ensembl | human accession no.

ENSG00000169398

NCBI accession no.

NM_153831

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... PTK2(5747), PTK2(5747)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
CAV
MVU
JUU
QCS
XRS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chang Liu et al.
Cancer medicine, 10(1), 337-349 (2020-12-07)
Lidocaine, one of the most commonly used local anesthetics during surgery, has been reported to suppress cancer cell growth via blocking voltage-gated sodium channels (VGSCs). VGSC 1.5 (NaV 1.5) is highly expressed in invasive cancers including ovarian cancer. This study
Irina M Shapiro et al.
Science translational medicine, 6(237), 237ra68-237ra68 (2014-05-23)
The goal of targeted therapy is to match a selective drug with a genetic lesion that predicts for drug sensitivity. In a diverse panel of cancer cell lines, we found that the cells most sensitive to focal adhesion kinase (FAK)
Qianfeng Zhuang et al.
Acta biochimica et biophysica Sinica, 50(5), 465-472 (2018-04-13)
Calpain small subunit 1 (Capn4) has been shown to correlate with the metastasis/invasion of clear cell renal cell carcinoma (ccRCC). This study aimed to further elucidate the molecular mechanisms underlying Capn4-mediated ccRCC progression. The mRNA expression levels in ccRCC cells
Qi Cao et al.
Oncotarget, 7(47), 77468-77481 (2016-10-21)
To investigate the effects of microRNA-7 (miR-7) on the proliferation, migration and invasion of non-small cell lung cancer NSCLC) cells by targeting FAK through ERK/MAPK signaling pathway. NSCLC tissues and adjacent normal tissues were obtained from 160 NSCLC patients after
Pachiyappan Kamarajan et al.
PLoS pathogens, 16(10), e1008881-e1008881 (2020-10-02)
Epidemiological studies reveal significant associations between periodontitis and oral cancer. However, knowledge about the contribution of periodontal pathogens to oral cancer and potential regulatory mechanisms involved is limited. Previously, we showed that nisin, a bacteriocin and commonly used food preservative
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique