Accéder au contenu
Merck

EHU078251

MISSION® esiRNA

targeting human CTH

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATTCGAAAGCCTTGCTGAGCTTCCGGCAATCATGACTCATGCATCAGTTCTTAAGAATGACAGAGATGTCCTTGGAATTAGTGACACACTGATTCGACTTTCTGTGGGCTTAGAGGATGAGGAAGACCTACTGGAAGATCTAGATCAAGCTTTGAAGGCAGCACACCCTCCAAGTGGAAGTCACAGCTAGTATTCCAGAGCTGCTATTAGAAGCTGCTTCCTGTGAAGATCAAATCTTCCTGAGTAATTAAATGGACCAACAATGAGCCTTTGCAAAATTTTCAAGCGGAAATTTTAAGGCACCTCATTATCTTTCATAACTGTAATTTTCTTAGGGATCATCTCTGTTAAAAAGTTTTCTGTATGTCATGTTATAATTACAGGTCAATTCTGTTAATATCTTTTTGTTAATTTTGCTCTATGTTTGCCTCTGAAGGAGGT

Ensembl | human accession no.

ENSG00000116761

NCBI accession no.

NM_001902

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Catégories apparentées

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
SNS
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wen-Long Xue et al.
American journal of physiology. Cell physiology, 318(5), C857-C869 (2020-03-19)
Diabetes (especially Type II) is one of the primary threats to cardiovascular health. Wound healing defects and vascular dysfunction are common in diabetic patients, and the primary cause of deterioration is sustained high plasma glucose. microRNA, a noncoding RNA, has
Neil Dufton et al.
Scientific reports, 2, 499-499 (2012-07-13)
Hydrogen sulfide is an essential gasotransmitter associated with numerous pathologies. We assert that hydrogen sulfide plays an important role in regulating macrophage function in response to subsequent inflammatory stimuli, promoting clearance of leukocyte infiltrate and reducing TNF-α levels in vivo
Zhongjian Cheng et al.
Circulation, 134(19), 1467-1483 (2016-09-24)
Bone marrow cell (BMC)-based treatment for critical limb ischemia in diabetic patients yielded a modest therapeutic effect resulting from cell dysfunction. Therefore, approaches that improve diabetic stem/progenitor cell functions may provide therapeutic benefits. Here, we tested the hypothesis that restoration
Qian-Rong Qi et al.
Endocrinology, 161(11) (2020-09-29)
Angiogenesis is a physiological process for endometrial regeneration in the menstrual cycle and remodeling during pregnancy. Endogenous hydrogen sulfide (H2S), produced by cystathionine-β synthase (CBS) and cystathionine-γ lyase (CSE), is a potent proangiogenic factor; yet, whether the H2S system is
Daoliang Xu et al.
Pharmacological research, 117, 357-369 (2017-01-15)
It has been suggested that excessive apoptosis in intervertebral disc cells induced by inflammatory cytokines, such as interleukin (IL)-1β, is related to the process of intervertebral disc degeneration (IVDD). Hydrogen sulfide (H
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique