Accéder au contenu
Merck

EHU079921

MISSION® esiRNA

targeting human MCL1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCTCCCCATTGATTGAAGAGTCACTGTCTGAAAGAAGCAAAGTTCAGTTTCAGCAACAAACAAACTTTGTTTGGGAAGCTATGGAGGAGGACTTTTAGATTTAGTGAAGATGGTAGGGTGGAAAGACTTAATTTCCTTGTTGAGAACAGGAAAGTGGCCAGTAGCCAGGCAAGTCATAGAATTGATTACCCGCCGAATTCATTAATTTACTGTAGTGTTAAGAGAAGCACTAAGAATGCCAGTGACCTGTGTAAAAGTTACAAGTAATAGAACTATGACTGTAAGCCTCAGTACTGTACAAGGGAAGCTTTTCCTCTCTCTAATTAGCTTTCCCAGTATACTTCTTAGAAAGTCCAAGTGTTCAGGACTTTTATACCTGTTATACTTTGGCTTGGTTTCCATG

Ensembl | human accession no.

ENSG00000143384

NCBI accession no.

NM_021960

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... MCL1(4170), MCL1(4170)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
OFU
IYT
UUT
MBT
HQS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eimear O' Reilly et al.
Scientific reports, 8(1), 15752-15752 (2018-10-27)
Acute myeloid leukaemia (AML) is an aggressive cancer with 50-75% of patients relapsing even after successful chemotherapy. The role of the bone marrow microenvironment (BMM) in protecting AML cells from chemotherapeutics and causing consequent relapse is increasingly recognised. However the
Sachie Hirai et al.
Biochemical and biophysical research communications, 526(2), 417-423 (2020-04-01)
Although most EGFR-mutant lung adenocarcinomas initially respond to EGFR inhibitors, disease progression almost inevitably occurs. We previously reported that two EGFR-mutant lung adenocarcinoma cell lines, HCC827 and H1975, contain subpopulations of cells that display an epithelial-to-mesenchymal phenotype and can thrive
Enyuan Shang et al.
Scientific reports, 8(1), 15383-15383 (2018-10-20)
XPO1 has recently emerged as a viable treatment target for solid malignancies, including glioblastoma (GBM), the most common primary malignant brain tumor in adults. However, given that tumors become commonly resistant to single treatments, the identification of combination therapies is
Yuto Yasuda et al.
Cell death & disease, 11(3), 177-177 (2020-03-11)
There have been few advances in the treatment of small-cell lung cancer (SCLC) because of the lack of targets. MCL1, a member of the anti-apoptotic BCL-2 family, may be a treatment target in several cancers, including SCLC. However, whether the
Takahito Sugase et al.
Cancer research, 77(24), 6975-6986 (2017-10-19)
STAT3 has been implicated recently in radioresistance in cancer. In this study, we investigated the association between STAT3 and radioresistance in esophageal squamous cell carcinoma (ESCC). Strong expression of activated phospho-STAT3 (p-STAT3) was observed in 16/22 ESCC patients with preoperative
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique