Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCACCTTAGGTCCCTTTGGAAACATTCCATTTGACTTTTCCCTGTTGTTTGAAATCCCATGTTTCCCTAAACCTCTAGCCTGATTGTTCTTTCCCTAATTCATTGCACAAGCTCCTTTGCTTTTAGTGTTACCGCTCATTGCCTCTCTAATCCTGCCTGATTGTGTTTACAGAAGCTTCTGATTTGCATTGAACATGCTCTAACTGGCCTGTGCTACTTATTACCGGGCTTGTAATAGCGGTTCTTGTCTCCATAGCCTGTTGAGTGTTCCCAGATGTGACTCACCTTTCTGCTGCCCTCTTCATGCAGGCCTACTGACTCATAATTCACTTGTCCCAAAAGCCACCCCACAAGCCTGAGCCAACCTGCTGCCTGACGCCACAGTCATTGGCAGAGGTCTGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PLEKHA7(144100)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Antonis Kourtidis et al.
Nature cell biology, 17(9), 1145-1157 (2015-08-25)
E-cadherin and p120 catenin (p120) are essential for epithelial homeostasis, but can also exert pro-tumorigenic activities. Here, we resolve this apparent paradox by identifying two spatially and functionally distinct junctional complexes in non-transformed polarized epithelial cells: one growth suppressing at