Accéder au contenu
Merck

EHU085471

MISSION® esiRNA

targeting human SDC3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCAACTCCAGAGACCTTCCTGACCACAATCCGGGATGAGCCAGAGGTTCCGGTGAGTGGGGGGCCCAGTGGAGACTTCGAGCTGCCAGAAGAAGAGACCACACAACCAGACACAGCCAATGAGGTGGTAGCTGTGGGAGGGGCTGCGGCCAAGGCATCATCTCCACCTGGGACACTGCCCAAGGGTGCCCGCCCGGGCCCTGGCCTCCTGGACAATGCCATCGACTCGGGCAGCTCAGCTGCTCAGCTGCCTCAGAAGAGTATCCTGGAGCGGAAGGAGGTGCTCGTAGCTGTGATTGTGGGCGGGGTGGTGGGCGCCCTCTTTGCTGCCTTCTTGGTCACACTGCTCATCTATCGTATGAAGAAAAAGGATGAGGGCAGCTACACGCTGGAGGAACCCAAGCAGGCGAGCGTCACATACCAGAAGCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SDC3(9672)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Anissa Kempf et al.
Developmental cell, 43(1), 24-34 (2017-09-26)
Heparan sulfate proteoglycans (HSPGs) critically modulate adhesion-, growth-, and migration-related processes. Here, we show that the transmembrane protein, Nogo-A, inhibits neurite outgrowth and cell spreading in neurons and Nogo-A-responsive cell lines via HSPGs. The extracellular, active 180 amino acid Nogo-A
Erik H Knelson et al.
The Journal of clinical investigation, 124(7), 3016-3031 (2014-06-18)
Neuroblastoma prognosis is dependent on both the differentiation state and stromal content of the tumor. Neuroblastoma tumor stroma is thought to suppress neuroblast growth via release of soluble differentiating factors. Here, we identified critical growth-limiting components of the differentiating stroma

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique