Accéder au contenu
Merck

EHU086621

MISSION® esiRNA

targeting human TLR4

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACAAAGGTGGGAATGCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTGCTGTTCTCAAAGTGATTTTGGGACAACCAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAACTAGAACATCTGGATTTCCAGCATTCCAATTTGAAACAAATGAGTGAGTTTTCAGTATTCCTATCACTCAGAAACCTCATTTACCTTGACATTTCTCATACTCACACCAGAGTTGCTTTCAATGGCATCTTCAATGGCTTGTCCAGTCTCGAAGTCTTGAAAATGGCTGGCAATTCTTTCCAGGAAAACTTCCTTCCAGATATCTTCACAGAGCTGAGAAACTTGACCTTCCTGGACCTCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Daniela Verzola et al.
Journal of cachexia, sarcopenia and muscle, 8(1), 131-144 (2016-11-30)
Inflammation in skeletal muscle is implicated in the pathogenesis of insulin resistance and cachexia but why uremia up-regulates pro-inflammatory cytokines is unknown. Toll-like receptors (TLRs) regulate locally the innate immune responses, but it is unknown whether in chronic kidney disease
Emmeline L Blanchard et al.
Molecular therapy. Nucleic acids, 14, 52-66 (2018-12-24)
The characterization of innate immune activation is crucial for vaccine and therapeutic development, including RNA-based vaccines, a promising approach. Current measurement methods quantify type I interferon and inflammatory cytokine production, but they do not allow for the isolation of individual pathways, do
Daohai Zhang et al.
Kidney & blood pressure research, 42(6), 1205-1215 (2017-12-12)
Hyperphosphatemia is one of the most notable features of chronic kidney disease (CKD). Numerous epidemiological and clinical studies have found that high serum phosphate concentrations are associated with calcification in the coronary arteries. However, the mechanisms underlying the vascular calcification
Zhenggang Luan et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(5), 1907-1918 (2018-05-03)
The high mobility group box 1 (HMGB1) has been regarded as an important inflammatory mediator. Previous studies showed the involvement of HMGB1 protein in the dysfunction of endothelial barrier function during acute lung injury. However, the molecular mechanism remains unclear.
Jing Chang et al.
PloS one, 12(9), e0184770-e0184770 (2017-09-13)
Interleukin 33 (IL-33), an inflammatory and mechanically responsive cytokine, is an important component of a TLR4-dependent innate immune process in mucosal epithelium. Although TLR4 also plays a role in sensing biomechanical stretch, a pathway of stretch-induced TLR4-dependent IL-33 biosynthesis has

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique