Accéder au contenu
Merck

EHU088101

MISSION® esiRNA

targeting human VCL

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGA

Ensembl | human accession no.

ENSG00000035403

NCBI accession no.

NM_003373

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... VCL(7414)

Catégories apparentées

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Stephen G Turney et al.
Molecular biology of the cell, 27(3), 500-517 (2015-12-04)
Nerve growth factor (NGF) promotes growth, differentiation, and survival of sensory neurons in the mammalian nervous system. Little is known about how NGF elicits faster axon outgrowth or how growth cones integrate and transform signal input to motor output. Using
Fangjia Li et al.
Scientific reports, 9(1), 5615-5615 (2019-04-06)
This study utilized a Förster resonance energy transfer (FRET)-based molecular tension sensor and live cell imaging to evaluate the effect of osteocytes, a mechanosensitive bone cell, on the migratory behavior of tumor cells. Two cell lines derived from MDA-MB-231 breast
Beenu Moza Jalali et al.
Theriogenology, 116, 17-27 (2018-05-16)
During early pregnancy, uterine epithelial cells undergo major transformations in their cytoskeleton that make the endometrium receptive for conceptus attachment. Actin binding proteins (ABPs) such as cofilin, gelsolin, and vinculin are involved in regulating actin polymerization, severing or crosslinking actin
Matthew G Rubashkin et al.
Cancer research, 74(17), 4597-4611 (2014-09-04)
Extracellular matrix (ECM) stiffness induces focal adhesion assembly to drive malignant transformation and tumor metastasis. Nevertheless, how force alters focal adhesions to promote tumor progression remains unclear. Here, we explored the role of the focal adhesion protein vinculin, a force-activated
Tanchen Ren et al.
Biomaterials, 56, 58-67 (2015-05-03)
Selective enhancement of directional migration of Schwann cells (SCs) over fibroblasts (FIBs) plays a significant role in peripheral nerve regeneration, because this behavior facilitates neuron repair and avoids fibrosis. Herein a complementary density gradient of poly(3-dimethyl-methacryloyloxyethyl ammonium propane sulfonate) (PDMAPS
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique