Accéder au contenu
Merck

EHU095021

MISSION® esiRNA

targeting human NELL1 (1)

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCCGTGCATTTAAGTCAATGGTTGTTAAAAGAAGTTTCCCGTGTTGTAAATCATGTTTCCCTTATCAGATCATTTGCAAATACATTTAAATGATCTCATGGTAAATGTTGATGTATTTTTTGGTTTATTTTGTGTACTAACATAATAGAGAGAGACTCAGCTCCTTTTATTTATTTTGTTGATTTATGGATCAAATTCTAAAATAAAGTTGCCTGTTGTGACTTTTGTCCCATCTACTGCATACTTAGTGCTGAGATCCCTGTAAAATGTTTTGATGAAAATATGTATGTAGAGTCCAGTCGCATTATACATACATTTCATAGTGCTGAACCTTCTTAAATGCC

Ensembl | human accession no.

ENSG00000165973

NCBI accession no.

NM_006157

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... NELL1(4745), NELL1(4745)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Juan Cong Dong et al.
Journal of cellular and molecular medicine, 19(9), 2286-2295 (2015-07-07)
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed
Claudio Raimondi et al.
The Journal of experimental medicine, 211(6), 1167-1183 (2014-05-28)
To enable new blood vessel growth, endothelial cells (ECs) express neuropilin 1 (NRP1), and NRP1 associates with the receptor tyrosine kinase VEGFR2 after binding the vascular endothelial growth factor A (VEGF) to enhance arteriogenesis. We report that NRP1 contributes to
Anthony Ambesi et al.
Journal of cell science, 127(Pt 17), 3805-3816 (2014-07-02)
The fibronectin matrix plays a crucial role in the regulation of angiogenesis during development, tissue repair and pathogenesis. Previous work has identified a fibronectin-derived homophilic binding peptide, anastellin, as an effective inhibitor of angiogenesis; however, its mechanism of action is
Hong-Bo Pang et al.
Nature communications, 5, 4904-4904 (2014-10-04)
Neuropilins (NRPs) are trans-membrane receptors involved in axon guidance and vascular development. Many growth factors and other signalling molecules bind to NRPs through a carboxy (C)-terminal, basic sequence motif (C-end Rule or CendR motif). Peptides with this motif (CendR peptides)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique