Accéder au contenu
Merck

EHU106441

MISSION® esiRNA

targeting human PTEN

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human PTEN

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

Ensembl | human accession no.

ENSG00000171862

NCBI accession no.

NM_000314

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... PTEN(5728), PTEN(5728)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
VYU
XXT
LVT
BST
EPT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Hu Gao et al.
Reproduction (Cambridge, England) (2019-11-23)
Sertoli cells are indispensable for normal spermatogenesis and increasing evidence has shown that microRNAs (miRNAs) participate in the regulation of Sertoli cell growth. However, the functions and regulatory mechanisms of miRNAs in Sertoli cells of domestic animals have not been
Aram Ghalali et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110112-110112 (2020-04-16)
Akt kinase regulates several cellular processes, among them growth, proliferation and survival, and has been correlated to neoplastic disease. We report here crosstalk between several Akt regulatory phosphatases that controls the level of the activated form (phosphorylated) of Akt and
Ye Wang et al.
OncoTargets and therapy, 13, 1909-1919 (2020-03-19)
Berberine (BBR), a traditional Chinese medicine, has been shown effects on inhibiting cancer development. Autophagy-mediated resistance plays an important role in cancer progression; therefore, regulation of autophagy is a novel therapeutic strategy for cancer treatment. However, effects of BBR on
Huachao Shen et al.
Neuropathology : official journal of the Japanese Society of Neuropathology, 40(3), 224-231 (2020-02-11)
Neural stem cell (NSC) transplantation has emerged as a promising approach for the treatment of neurological disorders such as cerebral ischemia. As the majority of newly generated cells from exogenous NSCs fail to integrate into the ischemic brain and establish
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique