Accéder au contenu
Merck

EHU118761

MISSION® esiRNA

targeting human ITPR3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human ITPR3

Gene Information

human ... ITPR3(3710), ITPR3(3709)

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTGTGACACTCTGTTGATGTGCATCGTCACTGTCATGAACCATGGGCTACGCAACGGTGGTGGCGTGGGCGACATTCTCCGCAAGCCCTCCAAAGATGAGTCTCTCTTCCCAGCCCGAGTGGTCTATGACCTCCTGTTCTTCTTCATCGTCATCATCATTGTGCTGAACCTCATCTTTGGGGTAATCATCGACACCTTCGCTGACCTGCGTAGTGAGAAGCAGAAGAAGGAGGAGATTCTTAAGACGACATGCTTCATCTGTGGTCTGGAGAGGGACAAGTTTGATAACAAGACAGTGTCATTTGAGGAACACATCAAGCTGGAGCACAACATGTGGAACTACTTGTACTTCATTGTGCTGGTCCGCGTGAAGAACAAGACCGACTACACGGGCCCTGAGAGCTACGTGGCCCAGATGATCAAGAACAAGAACCTGGACTGGTTCCCCCGGATGCGGGCCATGTCCCTTGTCAGCAATGAGGGCGAGGGGGAGCAGAATGAGATTCGGATTCTCCAGGACAAGCTCAACTCCACCATGA

Ensembl | human accession no.

ENSG00000096433

NCBI accession no.

NM_002224

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
KUT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Julius Rönkkö et al.
Annals of clinical and translational neurology, 7(10), 1962-1972 (2020-09-20)
ITPR3, encoding inositol 1,4,5-trisphosphate receptor type 3, was previously reported as a potential candidate disease gene for Charcot-Marie-Tooth neuropathy. Here, we present genetic and functional evidence that ITPR3 is a Charcot-Marie-Tooth disease gene. Whole-exome sequencing of four affected individuals in
Francesca Iommelli et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(13), 3126-3136 (2018-04-06)
Purpose: Our aim was to test whether imaging with 18F-fluorothymidine (18F-FLT) PET/CT was able to detect the combined effects of EGFR and MET inhibitors in oncogene-driven non-small cell lung cancer (NSCLC) and to elucidate the mechanisms underlying the enhanced efficacy
Ming He et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(5), 902-914 (2019-03-29)
Objective- The topographical distribution of atherosclerosis in vasculature underscores the importance of shear stress in regulating endothelium. With a systems approach integrating sequencing data, the current study aims to explore the link between shear stress-regulated master transcription factor and its
Abdallah Mound et al.
Oncotarget, 8(42), 72324-72341 (2017-10-27)
Breast cancer remains a research priority due to its invasive phenotype. Although the role of ion channels in cancer is now well established, the role of inositol (1,4,5)-trisphosphate (IP
Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique