Accéder au contenu
Merck

EHU122051

MISSION® esiRNA

targeting human STAT3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STAT3(6774)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chengyang Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 743-756 (2017-09-28)
To evaluate the effect of Liuweibuqi capsules on chronic obstructive pulmonary disease (COPD) through the JAK/STAT pathway. Lung function was measured with a spirometer. Changes in lung histology were observed using H&E staining. Cigarette smoke extract combined with lipopolysaccharide (CSE+LPS)
Young Yun Jung et al.
Frontiers in pharmacology, 9, 531-531 (2018-06-15)
Because of the essential role of signal transducer and activator of transcription 3 (STAT3) in proliferation, anti-apoptosis, and chemoresistance of multiple myeloma (MM), we investigated whether icariin, a prenylated flavonol glycoside, inhibits both constitutive and inducible STAT3 activation in human
Cong Liu et al.
Cell cycle (Georgetown, Tex.), 18(18), 2215-2227 (2019-07-10)
Various drug treatments including doxorubicin (DOX) have been proved efficient in the suppression of breast cancer. Nonetheless, drug resistance became an obstacle in the therapeutic process. According to recent literatures, breast cancer stem cells (BCSCs) were considered contributing to drug
Thijs S Stutvoet et al.
The Journal of pathology, 249(1), 52-64 (2019-04-12)
Immune checkpoint inhibitors targeting programmed cell death protein 1 (PD-1) and programmed death-ligand 1 (PD-L1) have improved the survival of patients with non-small cell lung cancer (NSCLC). Still, many patients do not respond to these inhibitors. PD-L1 (CD274) expression, one
M Bam et al.
Translational psychiatry, 7(8), e1222-e1222 (2017-08-30)
Chronic inflammation is a characteristic of post-traumatic stress disorder (PTSD). The initiation of inflammation and molecules involved are not yet clearly understood. Here, we provide compelling evidence that the inflammation seen in PTSD may result from the dysregulated miRNA processing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique