Accéder au contenu
Merck

EHU126361

MISSION® esiRNA

targeting human SERPINB5

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCGTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTTCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCC

Ensembl | human accession no.

ENSG00000206075

NCBI accession no.

NM_002639

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Catégories apparentées

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
GAT
WNS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Feng Qiu et al.
Bioscience, biotechnology, and biochemistry, 82(8), 1366-1376 (2018-04-17)
The aim of the present study is to investigate the role of miR-21-5p in angiogenesis of human retinal microvascular endothelial cells (HRMECs). HRMECs were incubated with 5 mM glucose, 30 mM glucose or 30 mM mannitol for 24 h, 48 h or 72 h. Then, HRMECs
Ning Wang et al.
Human cell, 33(3), 663-675 (2020-05-16)
This study aims to investigate how Maspin affects the EMT and angiogenesis of gastric cancer (GC) cells via ITGB1/FAK pathway. Immunohistochemistry was used to evaluate the expressions of Maspin, ITGB1, FAK, E-cadherin, Vimentin, D2-40, and CD34 in GC and adjacent
Chikako Takeda et al.
Diagnostic pathology, 9, 205-205 (2014-11-02)
Maspin is a 42 kDa protein known to act as a tumor suppressor. Although its function has not been fully elucidated, numerous reports have investigated the prognostic impact of maspin in patients with several types of cancer. However, there have
Bo Mi Ku et al.
PloS one, 13(4), e0194730-e0194730 (2018-04-12)
AZD9291 (osimertinib) is approved for standard care in patients with EGFR T790M-positive non-small cell lung cancer (NSCLC) after prior EGFR TKI progression. Furthermore, AZD9291 is now being evaluated as a first-line treatment for NSCLC patients with activation EGFR mutations. Based
Yu-Hsiang Lin et al.
Cancers, 12(1) (2019-12-22)
Maspin is a member of the clade B serine protease inhibitor superfamily and exhibits diverse regulatory effects in various types of solid tumors. We compared the expressions of maspin and determined its potential biological functions and regulatory mechanisms in bladder
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique