Accéder au contenu
Merck

EHU130111

MISSION® esiRNA

targeting human CTCF

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTGGTAATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGTGTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCCACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCCTCCTGAGGAATCACCTTAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCGACATGGCCTTTGTGACCAGTGGAGAATTGGTTCGGCATCGTCGTTACAAACACACCCACGAGAAGCCATTCAAGTGTTCCATGTGCGATTACGCCAGTGTAGAAGTCAGCAAATTAAAACGTCACATTCGCTCTCATACTGGAGAGCGTCCGTTTCAGTGCAGTTTGTGCAGTTATGCCAGCAGGGACACATACAAGCTGAAAAGGCACATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CTCF(10664)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Nathan A Damaschke et al.
Clinical epigenetics, 12(1), 80-80 (2020-06-07)
The chromatin insulator CCCTC-binding factor (CTCF) displays tissue-specific DNA binding sites that regulate transcription and chromatin organization. Despite evidence linking CTCF to the protection of epigenetic states through barrier insulation, the impact of CTCF loss on genome-wide DNA methylation sites
Tommy W Terooatea et al.
Nucleic acids research, 44(21), e159-e159 (2016-08-24)
Recently, a number of advances have been implemented into the core ChIP-seq (chromatin immunoprecipitation coupled with next-generation sequencing) methodology to streamline the process, reduce costs or improve data resolution. Several of these emerging ChIP-based methods perform additional chemical steps on
Zhengfei Shan et al.
Journal of cellular and molecular medicine, 23(5), 3130-3139 (2019-03-16)
The present research focuses on the influence of CCCTC-binding factor (CTCF) on prostate cancer (PC) via the regulation of the FoxO signalling pathway. A bioinformatics analysis was conducted to screen out target genes for CTCF in LNCaP cells and to