Accéder au contenu
Merck

EHU132881

MISSION® esiRNA

targeting human APLNR

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCATCATGCTGACCTGTTACTTCTTCATCGCCCAAACCATCGCTGGCCACTTCCGCAAGGAACGCATCGAGGGCCTGCGGAAGCGGCGCCGGCTGCTCAGCATCATCGTGGTGCTGGTGGTGACCTTTGCCCTGTGCTGGATGCCCTACCACCTGGTGAAGACGCTGTACATGCTGGGCAGCCTGCTGCACTGGCCCTGTGACTTTGACCTCTTCCTCATGAACATCTTCCCCTACTGCACCTGCATCAGCTACGTCAACAGCTGCCTCAACCCCTTCCTCTATGCCTTTTTCGACCCCCGCTTCCGCCAGGCCTGCACCTCCATGCTCTGCTGTGGCCAGAGCAGGTGCGCAGGCACCTCCCACAGCAGCAGTGGGGAGAAGTCAGCCAGCTACTCTTCGGGGCACAGCCAGGGGCCCGGCCCCAACATGGGCAAGGGTGGAGAACAGATGCACGAGAAATCCATCCCCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... APLNR(187)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lei Cui et al.
Anti-cancer drugs, 30(9), 940-947 (2019-03-29)
Osteosarcoma is the most common type of bone malignancies with a poor prognosis. In recent years, targeted therapy has shown great potential in the treatment of osteosarcoma, and more effective therapeutic targets for this disease need to be developed. APLNR
Lu Zhou et al.
American journal of physiology. Endocrinology and metabolism, 316(5), E773-E781 (2019-03-13)
Preeclampsia (PE) is a major cause of maternal mortality and morbidity worldwide. Although there has been great progress in the understanding of PE, the exact cause for the disease development is still unclear. Recently, studies showed that genetic deletion of
Bingyuan Ji et al.
Cellular signalling, 73, 109671-109671 (2020-05-15)
Apelin receptor (APJ) and bradykinin B2 receptor (B2R) play an important role in many physiological processes and share multiple similar characteristics in distribution and functions in the cardiovascular system. We first identified the endogenous expression of APJ and B2R in
Weilin Xu et al.
Journal of neuroinflammation, 16(1), 247-247 (2019-12-04)
Neuroinflammation and oxidative stress play important roles in early brain injury following subarachnoid hemorrhage (SAH). This study is the first to show that activation of apelin receptor (APJ) by apelin-13 could reduce endoplasmic reticulum (ER)-stress-associated inflammation and oxidative stress after
Andrew G Masoud et al.
The Journal of clinical investigation, 130(1), 94-107 (2019-11-19)
Sustained, indolent immune injury of the vasculature of a heart transplant limits long-term graft and recipient survival. This injury is mitigated by a poorly characterized, maladaptive repair response. Vascular endothelial cells respond to proangiogenic cues in the embryo by differentiation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique