Accéder au contenu
Merck

EHU136431

MISSION® esiRNA

targeting human NRGN

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting human NRGN

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGCGCGGGCGGCGGCCCCAGCGGAGACTAGGCCAGAAGAACTGAGCATTTTCAAAGTTCCCGAGGAGAGATGGATGCCGCGTCCCCTTCGCAGCGACGAGACTTCCCTGCCGTGTTTGTGACCCCCTCCTGCCCAGCAACCTGCCAGCTACAGGAGCCCCCTGCGTCCCAGAGACTCCCTCACCCAGGCAGGCTCCGTCGCGGAGTCGCTGAGTCCGTGCCCTTTTAGTTAGTTCTGCAGTCTAGTATGGTCCCCATTTGCCCTTCCACTCCACCCCACCCTAAACCATGCGCTCCCAATCTTCCTTCTTTTGCTTCTCGC

Ensembl | human accession no.

ENSG00000154146

NCBI accession no.

NM_001126181

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... NRGN(4900), NRGN(4900)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Isabel Weinheimer et al.
The Journal of general virology, 95(Pt 2), 486-495 (2013-11-05)
Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus, family Closteroviridae) causes heavy yield losses in sweet potato plants co-infected with other viruses. The dsRNA-specific class 1 RNase III-like endoribonuclease (RNase3) encoded by SPCSV suppresses post-transcriptional gene silencing and eliminates antiviral
Mariana Marin et al.
Viruses, 11(2) (2019-01-30)
The HIV-1 entry pathway into permissive cells has been a subject of debate. Accumulating evidence, including our previous single virus tracking results, suggests that HIV-1 can enter different cell types via endocytosis and CD4/coreceptor-dependent fusion with endosomes. However, recent studies
Mirko Theis et al.
Journal of biomolecular screening, 20(8), 1018-1026 (2015-04-26)
Broad sequencing enterprises such as the FANTOM or ENCODE projects have substantially extended our knowledge of the human transcriptome. They have revealed that a large portion of genomic DNA is actively transcribed and have identified a plethora of novel transcripts.
Colin Watanabe et al.
RNA biology, 13(1), 25-33 (2016-01-21)
Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional
Luca Goitre et al.
Scientific reports, 7(1), 8296-8296 (2017-08-16)
The intracellular scaffold KRIT1/CCM1 is an established regulator of vascular barrier function. Loss of KRIT1 leads to decreased microvessel barrier function and to the development of the vascular disorder Cerebral Cavernous Malformation (CCM). However, how loss of KRIT1 causes the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique