Accéder au contenu
Merck

EHU139921

MISSION® esiRNA

targeting human KAT5

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCACCCGGATGAAGAACATTGAGTGCATTGAGCTGGGCCGGCACCGCCTCAAGCCGTGGTACTTCTCCCCGTACCCACAGGAACTCACCACATTGCCTGTCCTCTACCTGTGCGAGTTCTGCCTCAAGTACGGCCGTAGTCTCAAGTGTCTTCAGCGTCATTTGACCAAGTGTGACCTACGACATCCTCCAGGCAATGAGATTTACCGCAAGGGCACCATCTCCTTCTTTGAGATTGATGGACGTAAGAACAAGAGTTATTCCCAGAACCTGTGTCTTTTGGCCAAGTGTTTCCTTGACCATAAGACACTGTACTATGACACAGACCCTTTCCTCTTCTACGTCATGACAGAGTATGACTGTAAGGGCTTCCACATCGTGGGCTACTTCTCCAAGGAGAAAGAATCAACGGAAGACTACAATGTGGCCTGCATCCTAAC

Ensembl | human accession no.

ENSG00000172977

NCBI accession no.

NM_006388

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
HYU
ZXU
DUU
IEU
GGT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xueqin Wang et al.
BMC microbiology, 10, 228-228 (2010-08-28)
Salmonella enterica is a facultative intracellular pathogen that replicates within a membrane-bound compartment termed Salmonella containing vacuole (SCV). The biogenesis of SCV requires Salmonella type III protein secretion/translocation system and their effector proteins which are translocated into host cells to
Jian Li et al.
PloS one, 6(8), e23725-e23725 (2011-08-23)
GPR50 is an orphan G-protein coupled receptor most closely related to the melatonin receptors. The physiological function of GPR50 remains unclear, although our previous studies implicate the receptor in energy homeostasis. Here, we reveal a role for GPR50 as a
Shengyuan Zeng et al.
Protein & cell, 8(3), 202-218 (2016-10-16)
UHRF2 is a ubiquitin-protein ligase E3 that regulates cell cycle, genomic stability and epigenetics. We conducted a co-immunoprecipitation assay and found that TIP60 and HDAC1 interact with UHRF2. We previously demonstrated that UHRF2 regulated H3K9ac and H3K14ac differentially in normal
Deepa Rajagopalan et al.
PLoS pathogens, 13(10), e1006681-e1006681 (2017-10-19)
HIV1-TAT interactive protein (TIP60) is a haploinsufficient tumor suppressor. However, the potential mechanisms endowing its tumor suppressor ability remain incompletely understood. It plays a vital role in virus-induced cancers where TIP60 down-regulates the expression of human papillomavirus (HPV) oncoprotein E6
Tara Procida et al.
International journal of molecular sciences, 22(2) (2021-01-16)
Histone variants differ in amino acid sequence, expression timing and genomic localization sites from canonical histones and convey unique functions to eukaryotic cells. Their tightly controlled spatial and temporal deposition into specific chromatin regions is accomplished by dedicated chaperone and/or
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique