Accéder au contenu
Merck

EHU159481

MISSION® esiRNA

targeting human NCOR2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACGAGGTGTCAGAGATCATCGATGGCCTCTCAGAGCAGGAGAACCTGGAGAAGCAGATGCGCCAGCTGGCCGTGATCCCGCCCATGCTGTACGACGCTGACCAGCAGCGCATCAAGTTCATCAACATGAACGGGCTTATGGCCGACCCCATGAAGGTGTACAAAGACCGCCAGGTCATGAACATGTGGAGTGAGCAGGAGAAGGAGACCTTCCGGGAGAAGTTCATGCAGCATCCCAAGAACTTTGGCCTGATCGCATCATTCCTGGAGAGGAAGACAGTGGCTGAGTGCGTCCTCTATTACTACCTGACTAAGAAGAATGAGAACTATAAGAGCCTGGTGAGACGGAGCTATCGGCGCCGCGGCAAGAGCCAGCAGCAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCCCATGCCCCGCAGCAGCCAGGAGGAGAAAGATGAGAAGGAGAAGGAAAAGGAGGCGGAGAAGGAGGAGGAGAAGCCGGAGGTGGAGAACGACAAGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... NCOR2(9612)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ligand Activation of PPARγ by Ligustrazine Suppresses Pericyte Functions of Hepatic Stellate Cells via SMRT-Mediated Transrepression of HIF-1α.
Feng Zhang et al.
Theranostics, 8(3), 610-626 (2018-01-19)
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Jil Sander et al.
Immunity, 47(6), 1051-1066 (2017-12-21)
Human in vitro generated monocyte-derived dendritic cells (moDCs) and macrophages are used clinically, e.g., to induce immunity against cancer. However, their physiological counterparts, ontogeny, transcriptional regulation, and heterogeneity remains largely unknown, hampering their clinical use. High-dimensional techniques were used to elucidate transcriptional, phenotypic
Nikhil Sharma et al.
Neuron, 102(2), 390-406 (2019-03-09)
Neuronal activity-dependent transcription is tuned to ensure precise gene induction during periods of heightened synaptic activity, allowing for appropriate responses of activated neurons within neural circuits. The consequences of aberrant induction of activity-dependent genes on neuronal physiology are not yet

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique