Accéder au contenu
Merck

EMU014751

MISSION® esiRNA

targeting mouse Eif2ak3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGATCAAATGGAAGCCCTTAATCCATTCTCCTTCTAGGACTCCTGTCTTGGTTGGGTCTGATGAATTTGACAAATGTCTAAGTAATGATAAGTATTCCCACGAAGAATACAGTAATGGTGCACTTTCAATCCTCCAGTATCCATACGATAACGGTTACTATCTGCCATACTACAAGAGAGAAAGGAATAAGCGGAGCACGCAGATCACAGTCAGGTTCCTGGACAGCCCCCACTACAGCAAGAACATCCGCAAGAAGGACCCTATCCTCCTGCTGCACTGGTGGAAGGAGATATTCGGGACGATCCTGCTTTGCATCGTAGCCACGACCTTCATCGTGCGCAGGCTTTTCCATCCTCAGCCCCACAGGCAGCGGAAGGAGTCTGAAACTCAGTGCCAGACTGAAAGTAAATACGACTCCGTGAGTGCC

Ensembl | mouse accession no.

ENSMUSG00000031668

NCBI accession no.

NM_010121

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... EIF2AK3(13666), Eif2ak3(13666)

Catégories apparentées

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
QXU
QCS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yue Wang et al.
Antiviral research, 106, 33-41 (2014-04-01)
The unfolded protein response (UPR) is cyto-protective machinery elicited towards an influx of large amount of protein synthesis in the endoplasmic reticulum (ER). Extensive studies suggest that the UPR can also be activated during virus infection. In the present studies
Genkai Guo et al.
Journal of immunology research, 2015, 183738-183738 (2015-06-20)
Previous studies indicated that bone marrow mesenchymal stem cells (BM-MSCs) from patients with systemic lupus erythematosus (SLE) exhibited the phenomenon of apoptosis. In this study, we aimed to investigate whether apoptosis of BM-MSCs from SLE patients were dysregulated. In this
Fei Sun et al.
Toxicology, 325, 52-66 (2014-08-19)
While it has been well-documented that excessive fluoride exposure caused the skeletal disease and osteoblasts played a critical role in the advanced skeletal fluorosis, the underlying mechanism that mediated these effects remain poorly understood. The present study was undertaken to
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique