Accéder au contenu
Merck

EMU015461

MISSION® esiRNA

targeting mouse Sgpp1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

Changer de vue

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGGGCTGATTCTCATTCCCTGCTGGAGTTCACTAGTTTGCCTAAGTAGAATCTACATGGGAATGCATTCTATCCTGGATGTCATTGCTGGATTCTTGTATACCATTTTAATCTTAATTATCTTCTACCCATTGGTGGACCTGATTGACAACTTCAACCAAACTTACAAATATGCGCCGCTCATCATCATCGGGCTTCACTTAATTTTGGGCATCTTCTCTTTCACCCTTGACACCTGGAGCACATCCCGAGGAGACACGGCTGAGATTCTGGGAAGTGGTGCTGGGATTGCATGTGGCTCACACGCTGCTTATACCCTGGGCCTATCCTTAGAACCTTCTCTGCACATGTTACCCTTAGCTATCCCCCCTCTTACTGTAACTCTGTTTGGAAAAGCCATATTACGGATCGTCCTAGGAATGCTGCTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents



Susumu Takeuchi et al.
International journal of oncology, 44(6), 1886-1894 (2014-04-10)
Pemetrexed (PEM) is currently recommended as one of the standard anticancer drugs for malignant pleural mesothelioma (MPM). However, the mechanism of the sensitivity of MPM to PEM remains unclear. We analyzed the antitumor effects of PEM in six MPM cell
Jun Won Park et al.
Laboratory investigation; a journal of technical methods and pathology, 95(6), 660-671 (2015-04-14)
Osteopontin (OPN) is a multifunctional protein that plays a role in many physiological and pathological processes, including inflammation and tumorigenesis. Here, we investigated the involvement of OPN in Helicobacter pylori (HP)-induced gastritis using OPN knockout (KO) mice and OPN knockdown
Yunsheng Yuan et al.
Applied biochemistry and biotechnology, 173(2), 421-432 (2014-03-26)
Secreted phosphoprotein 1 (SPP1) is a phosphorylated acidic glycoprotein. It is broadly expressed in a variety of tissues, and it is involved in a number of physiological and pathological events, including cancer metastasis, tissues remodeling, pro-inflammation regulation, and cell survival.