Accéder au contenu
Merck

EMU020501

MISSION® esiRNA

targeting mouse Bag3

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

product line

MISSION®

description

Powered by Eupheria Biotech

form

lyophilized powder

esiRNA cDNA target sequence

AGCAATTGATGTCCCAGGTCAAGTACAAGTCTATGAACTCCAGCCCAGCAACCTTGAGGCCGAGCAGCCACTCCAGGAAATCATGGGTGCCGTGGTAGCCGACAAGGATGAGAAAGGTCCTGAAAACAAAGATCCACAAACTGAAAGCCAACAGCTAGAAGCCAAAGCAGCCACACCTCCAAATCCCAGCAACCCAGCAGACTCAGCTGGCAACCTGGTGGCTCCCTAGTGTCCCCTGGGACCATGCTGTAGAGACTTTTAAGTTGCATGCACTGCGGGACTTGCAGTCAGCTGGCTGCCATTATTCATAGCCACTTGGTATGCAGTAACTTGGGGTGGAGGTAAAACACTAACAAAGGGGGCTTTTCTTCCATAGTCTATTCTGTATAAATAATAAGTTGCCTGTTCCAGAAGTCTAACCCTAACCCCTCTGGTTGTCTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Georg Karpel-Massler et al.
Oncotarget, 6(16), 14507-14521 (2015-05-27)
Despite great efforts taken to advance therapeutic measures for patients with glioblastoma, the clinical prognosis remains grim. The antiapoptotic Bcl-2 family protein Mcl-1 is overexpressed in glioblastoma and represents an important resistance factor to the BH-3 mimetic ABT263. In this
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Young-Hee Jin et al.
Biochemical and biophysical research communications, 464(2), 561-567 (2015-07-15)
Bcl2-associated athoanogene (BAG) 3 is a member of the co-chaperone BAG family. It is induced by stressful stimuli such as heat shock and heavy metals, and it regulates cellular adaptive responses against stressful conditions. In this study, we identified a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique