Accéder au contenu
Merck

EMU026571

MISSION® esiRNA

targeting mouse Hmox1

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

Nom du produit

MISSION® esiRNA, targeting mouse Hmox1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCGAATGAACACTCTGGAGATGACACCTGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTGAGCTGTTTGAGGAGCTGCAGGTGATGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGATGGCGTCACTTCGTCAGAGGCCTGCTAGCCTGGTGCAAGATACTGCCCCTGCAGAGACACCCCGAGGGAAACCCCAGATCAGCACTAGCTCATCCCAGACACCGCTCCTCCAGTGGGTCCTCACTCTCAGCTTCCTGTTGGCAACAGTGGCAGTGGGAATTTATGCCATGTAAATGCAATACTGGCCCCCAGGGGCTGTGAACTCTGTCCAATGTGGCCTTCTCTCTGTAAGGGAGAATCTTGCCTGGCTCTCTTCTCTTGGGCCTCTAAGAAAGCTTTTGGGGTCCCTAGCCCACTCCCTGTGTTTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gi Soo Youn et al.
Toxicology and applied pharmacology, 280(1), 42-52 (2014-07-30)
HIV-1 Tat causes extensive neuroinflammation that may progress to AIDS-related encephalitis and dementia. Celastrol possesses various biological activities such as anti-oxidant, anti-tumor, and anti-inflammatory activities. In this study, we investigated the modulatory effects of celastrol on HIV-1 Tat-induced inflammatory responses
Xiao Qiao Wang et al.
Biomedical and environmental sciences : BES, 27(10), 786-793 (2014-10-25)
To assess the effect of atorvastatin on lipopolysaccharide (LPS)-induced TNF-α production in RAW264.7 macrophages. RAW264.7 macrophages were treated in different LPS concentrations or at different time points with or without atorvastatin. TNF-α level in supernatant was measured. Expressions of TNF-α
So Ra Kim et al.
Biochemical pharmacology, 95(4), 279-289 (2015-04-22)
High mobility group box 1 (HMGB1) is now recognized as a late mediator of sepsis. We tested hypothesis that ascorbic acid (AscA) induces heme oxygenase (HO)-1 which inhibits HMGB1 release in lipopolysaccharide (LPS)-stimulated cells and increases survival of septic mice.
Yun-Jeong Choe et al.
International journal of oncology, 44(3), 761-768 (2013-12-25)
A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1
Li-Chin Sung et al.
Clinical and experimental pharmacology & physiology, 42(6), 632-639 (2015-05-02)
Lycopene is the most potent active antioxidant among the major carotenoids, and its use has been associated with a reduced risk for cardiovascular disease (CVD). Endothelin-1 (ET-1) is a powerful vasopressor synthesized by endothelial cells and plays a crucial role

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique