Accéder au contenu
Merck

EMU050341

MISSION® esiRNA

targeting mouse Sesn2

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAGCCTGCAGCCTCACCTATAACACCATCGCCATGCACAGTGGCGTGGACACCTCCATGCTCCGCAGGGCCATCTGGAACTACATCCACTGCGTCTTTGGCATCAGATACGATGACTATGATTACGGCGAGGTAAACCAGCTCCTGGAACGGAACCTCAAAATCTATATCAAGACGGTGGCCTGCTACCCTGAGAAGACGACCCGTAGGATGTACAACCTCTTTTGGAGGCACTTCCGCCACTCAGAGAAGGTTCATGTGAACTTGCTGCTCCTTGAAGCCCGCATGCAAGCGGCCCTGCTCTATGCCCTGCGCGCCATCACCCGCTACATGACCTGACTACCCCGTACGCAGGACCAGCACCAGGAGCAGCTGACCCTGGTCCACCGTCCTCTGTGCAAGGACTTCTGTGTCTGGAGACAGATCTGGGAAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hiroko Hamatani et al.
American journal of physiology. Renal physiology, 307(6), F708-F717 (2014-07-25)
Sestrin 2, initially identified as a p53 target protein, accumulates in cells exposed to stress and inhibits mammalian target of rapamycin (mTOR) signaling. In normal rat kidneys, sestrin 2 was selectively expressed in parietal epithelial cells (PECs), identified by the
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique