Accéder au contenu
Merck

EMU091061

MISSION® esiRNA

targeting mouse Rbpj

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement

A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324

Principaux documents

Voir toute la documentation
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTATGGCAACAGCGATGACATTGGTGTGTTCCTCAGCAAGCGGATAAAGGTCATCTCCAAACCCTCCAAAAAGAAGCAGTCACTGAAGAATGCTGACTTGTGCATTGCTTCAGGAACGAAGGTGGCACTGTTCAATCGCCTTCGGTCCCAGACAGTTAGTACCAGGTACCTGCATGTAGAAGGAGGGAATTTCCACGCCAGTTCACAACAGTGGGGAGCATTTTACATCCATCTCTTGGACGACGACGAGTCGGAAGGAGAGGAGTTCACAGTTAGAGATGGCTACATCCATTACGGGCAGACTGTCAAGCTTGTGTGCTCAGTGACTGGCATGGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACGGCATTACTGGATGCAGACGACCCTGTAT

Ensembl | mouse accession no.

ENSMUSG00000039191

NCBI accession no.

NM_001080927

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

mouse ... RBPJ(19664), Rbpj(19664)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
WNS
XWR
AOR

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

M Tanaka et al.
British journal of cancer, 100(12), 1957-1965 (2009-05-21)
The study shows constitutive activation of the Notch pathway in various types of malignancies. However, it remains unclear how the Notch pathway is involved in the pathogenesis of osteosarcoma. We investigated the expression of the Notch pathway molecules in osteosarcoma
Hideya Onishi et al.
Cancer letters, 371(2), 143-150 (2015-12-15)
We previously demonstrated that Hedgehog (Hh) signaling is activated under hypoxia through upregulation of transcription of Smoothened (SMO) gene. However, the mechanism of hypoxia-induced activation of SMO transcription remains unclear. In the analysis of altered expressions of genes related to
Hiroko Nagao et al.
PloS one, 7(7), e39268-e39268 (2012-07-14)
The Notch pathway regulates a broad spectrum of cell fate decisions and differentiation processes during fetal and postnatal development. In addition, the Notch pathway plays an important role in controlling tumorigenesis. However, the role of RBPJ, a transcription factor in
Robert J Lake et al.
PLoS genetics, 10(3), e1004204-e1004204 (2014-03-08)
Mechanisms that maintain transcriptional memory through cell division are important to maintain cell identity, and sequence-specific transcription factors that remain associated with mitotic chromatin are emerging as key players in transcriptional memory propagation. Here, we show that the major transcriptional
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique