Accéder au contenu
Merck

EMU177661

MISSION® esiRNA

targeting mouse Insr

Se connecter pour consulter les tarifs organisationnels et contractuels.

Sélectionner une taille de conditionnement


A propos de cet article

NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aider

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGCAGATCCTCCTGATGTTCAAGACCAGACCCGAAGATTTCCGAGACCTCAGTTTCCCCAAACTCATCATGATCACAGATTACCTGCTTCTCTTCCGTGTCTATGGTCTGGAAAGTCTGAAAGACCTCTTCCCAAATCTCACAGTCATCCGAGGCTCCCGTCTCTTCTTCAACTATGCCCTGGTTATCTTCGAGATGGTCCACCTGAAGGAGCTGGGGCTTTATAACCTCATGAACATCACCCGGGGCTCTGTCCGCATCGAGAAGAATAATGAGCTCTGCTACCTGGCCACTATCGACTGGTCCCGTATCCTGGATTCTGTGGAGGACAACTACATTGTACTGAACAAAGATGACAACGAGGAATGTGGGGATGTCTGTCCAGGCACCGCCAAGGGCAAGACCAACTGTCCTGCCACTGTCATCAATGGGCAGTTTGTGGAACGGTGCTGGACACACAGTCATTGTCAGAAAGTTTGCCCAACCATCTGTAAGTCACATGGCTGCACAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Classe de stockage

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Ingrit Hamann et al.
Archives of biochemistry and biophysics, 558, 42-50 (2014-06-17)
Copper ions are known to induce insulin-like effects in various cell lines, stimulating the phosphoinositide 3'-kinase (PI3K)/Akt signaling cascade and leading to the phosphorylation of downstream targets, including FoxO transcription factors. The aim of this work was to study the
Isabel Heidegger et al.
Oncotarget, 5(9), 2723-2735 (2014-05-09)
We scrutinized the effect of insulin receptor (INSR) in addition to IGF1R in PCa using in vitro and in vivo models. In-vitro overexpression of IGF1R and INSRA, but not INSRB increased cell proliferation, colony formation, migration, invasion and resistance to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique