Select a Size
About This Item
biological source
rabbit
Quality Level
antibody form
purified immunoglobulin
clone
monoclonal
species reactivity
human, chicken
manufacturer/tradename
ChIPAb+, Upstate®
technique(s)
ChIP: suitable, cell based assay: suitable, dot blot: suitable, immunoprecipitation (IP): suitable, western blot: suitable
isotype
IgG
NCBI accession no.
UniProt accession no.
shipped in
dry ice
General description
The ChIPAb+ Trimethyl-Histone H3 (Lys36) set includes the Trimethyl-Histone H3 (Lys36) antibody, a negative control antibody (normal rabbit IgG), and qPCR primers which amplify a 147 bp region of human BDNF intron. The Trimethyl-Histone H3 (Lys36) and negative control antibodies are supplied in a scalable "per ChIP" reaction size and can be used to functionally validate the precipitation of Trimethyl-Histone H3 (Lys36)-associated chromatin.
Immunogen
Application
Sonicated chromatin prepared from HeLa cells (1 X 106 cell equivalents per IP) were subjected to chromatin immunoprecipitation using 2 µg of either Normal rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP A Kit (Cat. # 17-610). Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron as a positive locus, and GAPDH promoter primers as a negative locus (Please see figures). Data is presented as percent input of each IP sample relative to input chromatin for each amplicon and ChIP sample as indicated.
Please refer to the EZ-Magna ChIP A (Cat. # 17-408) or EZ-ChIP (Cat. # 17-371) protocol for experimental details.
Western Blot Analysis and Peptide Inhibition:
Representative lot data.
Recombinant Histone H3 (Catalog # 14-411, lane 1) and chicken Core Histones (Catalog # 13-107, lane 2) were resolved by electrophoresis, transferred to nitrocellulose and probed with antitrimethyl-Histone H3 (Lys36) (1:1000 dilution) or anti-trimethyl-Histone H3 (Lys36) pre-adsorbed with 1mM histone H3 peptides containing the following modifications:
Lane 3: monomethyl-lysine 36
Lane 4: dimethyl-lysine 36
Lane 5: trimethyl-lysine 36
Lane 6: unmodified
Proteins were visualized using a goat anti-rabbit secondary antibody conjugated to HRP and a chemiluminescence detection system. (Please see figures).
Peptide Dot Blot Analysis:
Representative lot data.
A dilution series of Histone H3 peptides containing the following modifications was made:
Column 1: unmodified
Column 2: monomethyl-lysine 36
Column 3: dimethyl-lysine 36
Column 4: trimethyl-lysine 36
2 μL of each dilution was spotted onto a PVDF membrane and probed with antitrimethyl-Histone H3 (Lys36), (1:1000 dilution).
Peptides were visualized using a goat anti-rabbit secondary conjugated to HRP and a chemiluminescence detection system (Please see figures).
Epigenetics & Nuclear Function
Histones
Biochem/physiol Actions
Packaging
Physical form
Normal Rabbit IgG. One vial containing 125 µg Rabbit IgG in 125 µL of storage buffer containing 0.05% sodium azide. Store at -20°C.
ChIP Primers, BDNF Intron. One vial containing 75 μL of 5 μM of each primer specific for human BDNF intron. Store at -20°C.
FOR: ACCCCAACCTCTAACAGCATTA
REV: TGTCTCTCAGCAGTCTTGCATT
Preparation Note
Analysis Note
Sonicated chromatin prepared from HeLa cells (1 X 106 cell equivalents per IP) were subjected to chromatin immuno-precipitation using 2 µg of either Normal Rabbit IgG or 2 µL Anti-trimethyl-Histone H3 (Lys36) and the Magna ChIP® A Kit (Cat. # 17-610).
Successful immunoprecipitation of trimethyl-Histone H3 (Lys36) associated DNA fragments was verified by qPCR using ChIP Primers, BDNF Intron (Please see figures).
Please refer to the EZ-Magna ChIP A (Cat. # 17-408) or EZ-ChIP (Cat. # 17-371) protocol for experimental details.
Includes negative control rabbit IgG antibody and primers specific for human BDNF Intron.
Legal Information
Disclaimer
Storage Class
10 - Combustible liquids
wgk
WGK 2
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Epigenetics describes heritable changes in gene expression caused by non-genetic mechanisms. Epigenetic regulation allows a cell to vary its response based on its biological and environmental contexts. Epigenetic changes can effect transcriptional and post-transcriptional regulation via mechanisms such as histone modification, chromatin and nucleosome remodeling, DNA methylation, and small and non-coding RNA-mediated regulation. These mechanisms, in cooperation with transcription factors and other nucleic acid-binding proteins, regulate gene expression. Epigenetic mechanisms of gene regulation impacts diverse areas of research—from agriculture to human health. Common epigenetic assays such as chromatin immunoprecipitation (ChIP) and RNA immunoprecipitation (RIP) rely on high quality antibodies that recognize specific epigenetic modifications for accurate results. EMD Millipore offers over 100 ChIPAb+™ and RIPAb+™ validated antibody kits that are quality tested on ChIP/RIP assays and are conveniently provided with control qPCR primers and negative control antibodies to ensure first time ChIP/RIP success.
Signaling Product Guide: Antibodies, small molecule inhibitors, kits, assays and proteins for signaling research.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| 17-10032 | 04053252679223 |