Skip to Content
Merck

EHU010531

MISSION® esiRNA

targeting human MMP9

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGACAGCGACAAGAAGTGGGGCTTCTGCCCGGACCAAGGATACAGTTTGTTCCTCGTGGCGGCGCATGAGTTCGGCCACGCGCTGGGCTTAGATCATTCCTCAGTGCCGGAGGCGCTCATGTACCCTATGTACCGCTTCACTGAGGGGCCCCCCTTGCATAAGGACGACGTGAATGGCATCCGGCACCTCTATGGTCCTCGCCCTGAACCTGAGCCACGGCCTCCAACCACCACCACACCGCAGCCCACGGCTCCCCCGACGGTCTGCCCCACCGGACCCCCCACTGTCCACCCCTCAGAGCGCCCCACAGCTGGCCCCACAGGTCCCCCCTCAGCTGGCCCCACAGGTCCCCCCACTGCTGGCCCTTCTACGGCCACTACTGTGCCTTTGAGTCCGGTGGACGATGCCTGCAACGTGAACATCTTCGACG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MMP9(4318)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


Jiaoli Wang et al.
Oncotarget, 8(47), 81880-81891 (2017-11-16)
Obesity is involved in tumor progression. However, the corresponding mechanisms remain largely unknown. Here, we report that adipocytes increase the invasive ability of tumor cells by producing exosomes with a high level of MMP3. Compared with 3T3-L1 cells, 3T3-L1 adipocytes
Le-Ping Yan et al.
Materials science & engineering. C, Materials for biological applications, 114, 111022-111022 (2020-10-01)
Impaired wound healing of diabetic foot ulcers has been linked to high MMP-9 levels at the wound site. Strategies aimed at the simultaneous downregulation of the MMP-9 level in situ and the regeneration of impaired tissue are critical for improved
Jon M Florence et al.
PloS one, 12(2), e0171427-e0171427 (2017-02-07)
The atherosclerotic process begins when vascular endothelial cells undergo pro-inflammatory changes such as aberrant activation to dysfunctional phenotypes and apoptosis, leading to loss of vascular integrity. Our laboratory has demonstrated that exposure of mice to second hand smoke triggers an