Skip to Content
Merck

EHU029261

MISSION® esiRNA

targeting human FANCD2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCGACTTGACCCAAACTTCCTATTGAAGGTTCGCCAGTTGGTGATGGATAAGTTGTCGTCTATTAGATTGGAGGATTTACCTGTGATAATAAAGTTCATTCTTCATTCCGTAACAGCCATGGATACACTTGAGGTAATTTCTGAGCTTCGGGAGAAGTTGGATCTGCAGCATTGTGTTTTGCCATCACGGTTACAGGCTTCCCAAGTAAAGTTGAAAAGTAAAGGACGAGCAAGTTCCTCAGGAAATCAAGAAAGCAGCGGTCAGAGCTGTATTATTCTCCTCTTTGATGTAATAAAGTCAGCTATTAGATATGAGAAAACCATTTCAGAAGCCTGGATTAAGGCAATTGAAAACACTGCCTCAGTATCTGAACACAAGGTGTTTGACCTGGTGATGCTTTTCATCATCTATAGCACCAATACTCAGACAAAGAAGTACATTGACAGGGTGCTAAGAAATAAGATTCGATCAGGCTGCATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FANCD2(2177)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Jian Chen et al.
Hepatology (Baltimore, Md.), 65(2), 678-693 (2017-01-24)
Exposure to genotoxins such as ethanol-derived acetaldehyde leads to DNA damage and liver injury and promotes the development of cancer. We report here a major role for the transforming growth factor β/mothers against decapentaplegic homolog 3 adaptor β2-Spectrin (β2SP, gene
Anaid Benitez et al.
Molecular cell, 71(4), 621-628 (2018-07-31)
FANCA is a component of the Fanconi anemia (FA) core complex that activates DNA interstrand crosslink repair by monoubiquitination of FANCD2. Here, we report that purified FANCA protein catalyzes bidirectional single-strand annealing (SA) and strand exchange (SE) at a level
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for