Skip to Content
Merck

EHU030131

MISSION® esiRNA

targeting human ROCK2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTCTGAGCAACTGGCTCGTTCAATTGCTGAAGAACAATATTCTGATTTGGAAAAAGAGAAGATCATGAAAGAGCTGGAGATCAAAGAGATGATGGCTAGACACAAACAGGAACTTACGGAAAAAGATGCTACAATTGCTTCTCTTGAGGAAACTAATAGGACACTAACTAGTGATGTTGCCAATCTTGCAAATGAGAAAGAAGAATTAAATAACAAATTGAAAGATGTTCAAGAGCAACTGTCAAGATTGAAAGATGAAGAAATAAGCGCAGCAGCTATTAAAGCACAGTTTGAGAAGCAGCTATTAACAGAAAGAACACTCAAAACTCAAGCTGTGAATAAGTTGGCTGAGATCATGAATCGAAAAGAACCTGTCAAGCGTGGTAATGACACAGATGTGCGGAGAAAAGAGAAGGAGAATAGAAAGCTACATATGGAGCTTAAATCTGAACGTGAGAAATTGACCCAGCAGATGATCAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cecilia Dyberg et al.
Cancers, 12(1) (2020-01-01)
Medulloblastoma is one of the most common malignant brain tumor types in children, with an overall survival of 70%. Mortality is associated with metastatic relapsed tumors. Rho-associated kinases (ROCKs), important for epithelial-mesenchymal transition (EMT) and proper nervous system development, have
Ye Wang et al.
PloS one, 11(1), e0146646-e0146646 (2016-01-09)
Some recent studies suggest that multiple miRNAs might regulate neurogenic transdifferentiation of mesenchymal stromal cells (MSCs). In the present study, we hypothesized that the miR-124 can repress the expression of RhoA upon the neurogenesis of adipose derived MSCs (ADMSCs). MiRNA
Sarah Theresa Boyle et al.
Nature cell biology, 22(7), 882-895 (2020-05-27)
It is well accepted that cancers co-opt the microenvironment for their growth. However, the molecular mechanisms that underlie cancer-microenvironment interactions are still poorly defined. Here, we show that Rho-associated kinase (ROCK) in the mammary tumour epithelium selectively actuates protein-kinase-R-like endoplasmic
Ran You et al.
Clinical science (London, England : 1979), 134(12), 1357-1376 (2020-06-04)
Non-specific inhibition of Rho-associated kinases (ROCKs) alleviated renal fibrosis in the unilateral ureteral obstruction (UUO) model, while genetic deletion of ROCK1 did not affect renal pathology in mice. Thus, whether ROCK2 plays a role in renal tubulointerstitial fibrosis needs to
Ying-Ting Zhu et al.
The Journal of cell biology, 206(6), 799-811 (2014-09-10)
Currently there are limited treatment options for corneal blindness caused by dysfunctional corneal endothelial cells. The primary treatment involves transplantation of healthy donor human corneal endothelial cells, but a global shortage of donor corneas necessitates other options. Conventional tissue approaches

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service