Skip to Content
Merck

EHU078191

MISSION® esiRNA

targeting human TTC3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCTGAGCCAGCATCATTGAAGGAAGCCCGTTGTTTAATATGGCTGCTAGAAGAACACAGAGACAAGTTCCCAGCATTGCATAGTGCTTTAGATGAATTCTTTGATATAATGGACAGCCGCTGTACTGTGTTAAGGAAACAAGATAGTGGTGAAGCACCGTTTAGTTCAACCAAGGTGAAAAACAAAAGCAAGAAAAAGAAGCCAAAGGATTCAAAGCCTATGTTAGTTGGGTCTGGAACAACTTCAGTAACTTCAAATAATGAGATCATCACTTCAAGTGAAGACCATAGCAATCGAAATTCAGATTCTGCAGGCCCATTTGCAGTGCCTGACCATCTTCGGCAAGATGTAGAAGAATTCGAAGCTCTCTATGACCAACACAGTAACGAATATGTTGTCCGCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TTC3(7267)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Yang et al.
Stem cell research & therapy, 12(1), 125-125 (2021-02-14)
Stroke serves as a prevalent cerebrovascular disorder with severe cerebral ischemia/reperfusion (CIR) injury, in which neural stem cells (NSCs) play critical roles in the recovery of cerebral function. Circular RNAs (circRNAs) have been widely found to participate in stroke and
Chong Huang et al.
Molecular medicine reports, 16(5), 6269-6275 (2017-08-30)
Smoking is highly associated with cardiovascular diseases. However, the effect of nicotine, a key ingredient in smoking products, on cardiomyocyte apoptosis remains controversial. The present study aims to clarify the role of nicotine on cardiomyocyte cell apoptosis and to investigate

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service